| Title: | Genotype Calling with Uncertainty from Sequencing Data in Polyploids and Diploids |
|---|---|
| Description: | Read depth data from genotyping-by-sequencing (GBS) or restriction site-associated DNA sequencing (RAD-seq) are imported and used to make Bayesian probability estimates of genotypes in polyploids or diploids. The genotype probabilities, posterior mean genotypes, or most probable genotypes can then be exported for downstream analysis. 'polyRAD' is described by Clark et al. (2019) <doi:10.1534/g3.118.200913>, and the Hind/He statistic for marker filtering is described by Clark et al. (2022) <doi:10.1186/s12859-022-04635-9>. A variant calling pipeline for highly duplicated genomes is also included and is described by Clark et al. (2020, Version 1) <doi:10.1101/2020.01.11.902890>. |
| Authors: | Lindsay V. Clark [aut, cre]
|
| Maintainer: | Lindsay V. Clark <[email protected]> |
| License: | GPL (>= 2) |
| Version: | 2.0.1 |
| Built: | 2026-06-24 11:00:35 UTC |
| Source: | https://github.com/lvclark/polyRAD |
These functions can be used for accessing and replacing data within
a "RADdata" object. Data slots that do not yet have
accessors can be accessed and replaced using the $ operator or the
attr function.
GetTaxa(object, ...) GetLoci(object, ...) GetLocDepth(object, ...) GetContamRate(object, ...) SetContamRate(object, value, ...) nTaxa(object, ...) nLoci(object, ...) nAlleles(object, ...) GetAlleleNames(object, ...) GetTaxaPloidy(object, ...) SetTaxaPloidy(object, value, ...) GetTaxaByPloidy(object, ...) ## S3 method for class 'RADdata' GetTaxaByPloidy(object, ploidy, ...)GetTaxa(object, ...) GetLoci(object, ...) GetLocDepth(object, ...) GetContamRate(object, ...) SetContamRate(object, value, ...) nTaxa(object, ...) nLoci(object, ...) nAlleles(object, ...) GetAlleleNames(object, ...) GetTaxaPloidy(object, ...) SetTaxaPloidy(object, value, ...) GetTaxaByPloidy(object, ...) ## S3 method for class 'RADdata' GetTaxaByPloidy(object, ploidy, ...)
object |
A |
value |
A value to assign. For |
ploidy |
An integer indicating a single ploidy for which to return taxa. |
... |
Additional arguments (none currently supported). |
For GetTaxa and GetLoci, a character vector listing taxa names
or loci names, respectively. For GetLocDepth, a named matrix with
taxa in rows and loci in columns, giving the total read depth for each taxon
and locus. For GetContamRate, a number indicating the expected
contamination rate that is stored in the object. For SetContamRate, a
"RADdata" object with an updated contamination rate.
For nTaxa, the number of taxa in the object. For nLoci, the
number of loci in the object. For nAlleles, the
number of alleles across all loci in the object. For GetAlleleNames,
the names of all alleles. For GetTaxaPloidy, a named integer vector
indicating the ploidy of each taxon. For SetTaxaPloidy, a
"RADdata" object with the taxa ploidies updated. For
GetTaxaByPloidy, a character vector listing taxa.
Lindsay V. Clark
SetBlankTaxa for functions that assign taxa to particular roles.
data(exampleRAD) GetTaxa(exampleRAD) GetLoci(exampleRAD) GetLocDepth(exampleRAD) GetContamRate(exampleRAD) exampleRAD <- SetContamRate(exampleRAD, 0.0000001) GetContamRate(exampleRAD) nTaxa(exampleRAD) nAlleles(exampleRAD) GetAlleleNames(exampleRAD) GetTaxaPloidy(exampleRAD) exampleRAD <- SetTaxaPloidy(exampleRAD, rep(c(2, 5), time = c(75, 25))) GetTaxaByPloidy(exampleRAD, 2)data(exampleRAD) GetTaxa(exampleRAD) GetLoci(exampleRAD) GetLocDepth(exampleRAD) GetContamRate(exampleRAD) exampleRAD <- SetContamRate(exampleRAD, 0.0000001) GetContamRate(exampleRAD) nTaxa(exampleRAD) nAlleles(exampleRAD) GetAlleleNames(exampleRAD) GetTaxaPloidy(exampleRAD) exampleRAD <- SetTaxaPloidy(exampleRAD, rep(c(2, 5), time = c(75, 25))) GetTaxaByPloidy(exampleRAD, 2)
This function estimates allele frequencies per taxon, rather than for the whole
population. The best estimated genotypes (either object$depthRatio or
GetWeightedMeanGenotypes(object)) are regressed against principal
coordinate axes. The regression coefficients are then in turn used to
predict allele frequencies from PC axes. Allele frequencies outside of a
user-defined range are then adjusted so that they fall within that range.
AddAlleleFreqByTaxa(object, ...) ## S3 method for class 'RADdata' AddAlleleFreqByTaxa(object, minfreq = 0.0001, ...)AddAlleleFreqByTaxa(object, ...) ## S3 method for class 'RADdata' AddAlleleFreqByTaxa(object, minfreq = 0.0001, ...)
object |
|
minfreq |
The minimum allowable allele frequency to be output. The maximum allowable
allele frequency will be calculated as |
... |
Additional arguments (none implemented). |
For every allele, all PC axes stored in object$PCA are used for
generating regression coefficients and making predictions, regardless of whether
they are significantly associated with the allele.
object$depthRatio has missing data for loci with no reads; these missing
data are omitted on a per-allele basis when calculating regression coefficients.
However, allele frequencies are output for all taxa at all alleles, because
there are no missing data in the PC axes. The output of
GetWeightedMeanGenotypes has no missing data, so missing data are
not an issue when calculating regression coefficients using that method.
After predicting allele frequencies from the regression coefficients, the
function loops through all loci and taxa to adjust allele frequencies if necessary.
This is needed because otherwise some allele frequencies will be below zero or
above one (typically in subpopulations where alleles are near fixation),
which interferes with prior genotype probability estimation. For a
given taxon and locus, any allele frequencies below minfreq are adjusted
to be equal to minfreq, and any allele frequencies above 1 - minfreq
are adjusted to be 1 - minfreq. Remaining allele frequencies are adjusted
so that all allele frequencies for the taxon and locus sum to one.
A "RADdata" object identical to the one passed to the function, but with
a matrix of allele frequencies added to the $alleleFreqByTaxa slot. Taxa
are in rows and alleles in columns.
Lindsay V. Clark
# load data data(exampleRAD) # do PCA exampleRAD <- AddPCA(exampleRAD, nPcsInit = 3) # get allele frequencies exampleRAD <- AddAlleleFreqByTaxa(exampleRAD) exampleRAD$alleleFreqByTaxa[1:10,]# load data data(exampleRAD) # do PCA exampleRAD <- AddPCA(exampleRAD, nPcsInit = 3) # get allele frequencies exampleRAD <- AddAlleleFreqByTaxa(exampleRAD) exampleRAD$alleleFreqByTaxa[1:10,]
Allele frequencies are estimated based on the best parameters available.
object$alleleFreqByTaxa is used if available. If object$alleleFreqByTaxa
is null, GetWeightedMeanGenotypes is used, and if that isn't possible
object$depthRatio is used. From whichever of the three options is used,
column means are taken, the output of which is stored as object$alleleFreq.
AddAlleleFreqHWE(object, ...) ## S3 method for class 'RADdata' AddAlleleFreqHWE(object, excludeTaxa = GetBlankTaxa(object), ...)AddAlleleFreqHWE(object, ...) ## S3 method for class 'RADdata' AddAlleleFreqHWE(object, excludeTaxa = GetBlankTaxa(object), ...)
object |
A |
excludeTaxa |
A character vector indicating taxa that should be excluded from the calculation. |
... |
Included to allow more arguments in the future, although none are currently used. |
A "RADdata" object identical to the one passed to the function, but
with allele frequencies added to object$alleleFreq, and "HWE"
as the value for the "alleleFreqType" attribute.
Lindsay V. Clark
AddAlleleFreqMapping, AddGenotypePriorProb_HWE
# load in an example dataset data(exampleRAD) exampleRAD # add allele frequencies exampleRAD <- AddAlleleFreqHWE(exampleRAD) exampleRAD$alleleFreq# load in an example dataset data(exampleRAD) exampleRAD # add allele frequencies exampleRAD <- AddAlleleFreqHWE(exampleRAD) exampleRAD$alleleFreq
Estimate allele frequencies using data from a mapping population, assuming a fixed set of allele frequencies are possible.
AddAlleleFreqMapping(object, ...) ## S3 method for class 'RADdata' AddAlleleFreqMapping(object, expectedFreqs = seq(0, 1, 0.25), allowedDeviation = 0.05, excludeTaxa = c(GetDonorParent(object), GetRecurrentParent(object), GetBlankTaxa(object)), ...)AddAlleleFreqMapping(object, ...) ## S3 method for class 'RADdata' AddAlleleFreqMapping(object, expectedFreqs = seq(0, 1, 0.25), allowedDeviation = 0.05, excludeTaxa = c(GetDonorParent(object), GetRecurrentParent(object), GetBlankTaxa(object)), ...)
object |
A |
expectedFreqs |
A numeric vector listing all expected allele frequencies in the mapping population. |
allowedDeviation |
A value indicating how far an observed allele frequency can deviate from an
expected allele frequency and still be categorized as that allele frequency.
Must be no more than half the smallest interval seen in |
excludeTaxa |
A character vector indicating taxa that should be excluded from the allele frequency estimate. |
... |
Arguments to be passed to the method for |
Allele frequencies are first estimated as the column means of
object$depthRatio (unless posterior genotype probabilities and ploidy
chi-squared values have already been calculated, in which case
GetWeightedMeanGenotypes is run and the column means of its output are
taken), excluding any taxa listed in excludeTaxa.
These are then categorized based on which, if any, expected allele frequency
they match with, based on the intervals described by expectedFreqs and
allowedDeviation. If an allele frequency does not fall within any of
these intervals it is classified as NA; otherwise it is converted to the
matching value in expectedFreqs.
A "RADdata" object identical to the one passed to the function, but with
allele frequencies added to object$alleleFreq, and "mapping"
as the "alleleFreqType" attribute.
Lindsay V. Clark
# load example dataset data(exampleRAD_mapping) exampleRAD_mapping # specify parents exampleRAD_mapping <- SetDonorParent(exampleRAD_mapping, "parent1") exampleRAD_mapping <- SetRecurrentParent(exampleRAD_mapping, "parent2") # estimate allele frequencies in diploid BC1 population exampleRAD_mapping <- AddAlleleFreqMapping(exampleRAD_mapping, expectedFreqs = c(0.25, 0.75), allowedDeviation = 0.08) exampleRAD_mapping$alleleFreq# load example dataset data(exampleRAD_mapping) exampleRAD_mapping # specify parents exampleRAD_mapping <- SetDonorParent(exampleRAD_mapping, "parent1") exampleRAD_mapping <- SetRecurrentParent(exampleRAD_mapping, "parent2") # estimate allele frequencies in diploid BC1 population exampleRAD_mapping <- AddAlleleFreqMapping(exampleRAD_mapping, expectedFreqs = c(0.25, 0.75), allowedDeviation = 0.08) exampleRAD_mapping$alleleFreq
AddAlleleLinkages finds alleles, if any, in linkage disequilibrium
with each allele in a RADdata object, and computes a correlation
coefficient representing the strength of the linkage.
AddGenotypePriorProb_LD adds a second set of prior genotype
probabilities to a RADdata object based on the genotype posterior
probabilities at linked alleles.
AddAlleleLinkages(object, ...) ## S3 method for class 'RADdata' AddAlleleLinkages(object, type, linkageDist, minCorr, excludeTaxa = character(0), ...) AddGenotypePriorProb_LD(object, ...) ## S3 method for class 'RADdata' AddGenotypePriorProb_LD(object, type, ...)AddAlleleLinkages(object, ...) ## S3 method for class 'RADdata' AddAlleleLinkages(object, type, linkageDist, minCorr, excludeTaxa = character(0), ...) AddGenotypePriorProb_LD(object, ...) ## S3 method for class 'RADdata' AddGenotypePriorProb_LD(object, type, ...)
object |
A |
type |
A character string, either “mapping”, “hwe”, or “popstruct”, to indicate the type of population being analyzed. |
linkageDist |
A number, indicating the distance in basepairs from a locus within which to search for linked alleles. |
minCorr |
A number ranging from zero to one indicating the minimum correlation needed for an allele to be used for genotype prediction at another allele. |
excludeTaxa |
A character vector listing taxa to be excluded from correlation estimates. |
... |
Additional arguments (none implemented). |
These functions are primarily designed to be used internally by the pipeline functions.
AddAlleleLinkages obtains genotypic values using
GetWeightedMeanGenotypes, then regresses those values for a given
allele against those values for nearby alleles to obtain correlation coefficients.
For the population structure model, the genotypic values for an allele are
first regressed on the PC axes from object$PCA, then the residuals are
regressed on the genotypic values at nearby alleles to obtain correlation
coefficients.
AddGenotypePriorProb_LD makes a second set of priors in addition to
object$priorProb. This second set of priors has one value per
inheritance mode per taxon per allele per possible allele copy number.
Where is the ploidy, with allele copy number ranging from 0 to
, is an allele, is a linked allele at a different locus
out of total alleles linked to ,
is the correlation coefficient between those alleles, is a
taxon, is the posterior probability of a given allele copy
number for a given allele in a given taxon, and is the
prior probability for a given allele copy number for a given allele in a given
taxon based on linkage alone:
For mapping populations, AddGenotypePriorProb_LD uses the above formula
when each allele only has two possible genotypes (i.e. test-cross segregation).
When more genotypes are possible, AddGenotypePriorProb_LD instead estimates
prior probabilities as fitted values when the posterior probabilities for
a given allele are regressed on the posterior probabilities for a linked allele.
This allows loci with different segregation patterns to be informative for
predicting genotypes, and for cases where two alleles are in phase for some but not
all parental copies.
A RADdata object is returned. For AddAlleleLinkages, it has a new slot
called $alleleLinkages that is a list, with one item in the list for each
allele in the dataset. Each item is a data frame, with indices for linked alleles
in the first column, and correlation coefficients in the second column.
For AddGenotypePriorProb_LD, the object has a new slot called
$priorProbLD. This is a list much like $posteriorProb, with one list
item per inheritance mode, and each item being an array with allele copy number in
the first dimension, taxa in the second dimension, and alleles in the third dimension.
Values indicate genotype prior probabilities based on linked alleles alone.
Lindsay V. Clark
# load example dataset data(Msi01genes) # Run non-LD pop structure pipeline Msi01genes <- IteratePopStruct(Msi01genes, tol = 0.01, nPcsInit = 10) # Add linkages Msi01genes <- AddAlleleLinkages(Msi01genes, "popstruct", 1e4, 0.05) # Get new posterior probabilities based on those linkages Msi01genes <- AddGenotypePriorProb_LD(Msi01genes, "popstruct") # Preview results Msi01genes$priorProbLD[[1,2]][,1:10,1:10]# load example dataset data(Msi01genes) # Run non-LD pop structure pipeline Msi01genes <- IteratePopStruct(Msi01genes, tol = 0.01, nPcsInit = 10) # Add linkages Msi01genes <- AddAlleleLinkages(Msi01genes, "popstruct", 1e4, 0.05) # Get new posterior probabilities based on those linkages Msi01genes <- AddGenotypePriorProb_LD(Msi01genes, "popstruct") # Preview results Msi01genes$priorProbLD[[1,2]][,1:10,1:10]
For each possible allele copy number across each possible ploidy in each taxon,
AddGenotypeLikelihood estimates the probability of observing the
distribution of read counts that are recorded for that taxon and locus.
AddDepthSamplingPermutations is called by AddGenotypeLikelihood
the first time it is run, so that part of the likelihood calcluation is
stored in the RADdata object and doesn't need to be re-run on each
iteration of the pipeline functions.
AddGenotypeLikelihood(object, ...) ## S3 method for class 'RADdata' AddGenotypeLikelihood(object, overdispersion = 9, ...) AddDepthSamplingPermutations(object, ...)AddGenotypeLikelihood(object, ...) ## S3 method for class 'RADdata' AddGenotypeLikelihood(object, overdispersion = 9, ...) AddDepthSamplingPermutations(object, ...)
object |
A |
overdispersion |
An overdispersion parameter. Higher values will cause the expected read depth distribution to more resemble the binomial distribution. Lower values indicate more overdispersion, i.e. sample-to-sample variance in the probability of observing reads from a given allele. |
... |
Other arguments; none are currently used. |
If allele frequencies are not already recorded in object, they will
be added using AddAlleleFreqHWE. Allele frequencies are then
used for estimating the probability of sampling an allele from a genotype due
to sample contamination. Given a known genotype with copies of
allele , ploidy , allele frequency in the population used for
making sequencing libraries, and contamination rate , the probabiity of
sampling a read from that locus corresponding to that allele is
To estimate the genotype likelihood, where is the number of reads
corresponding to allele for a given taxon and locus and is the
number of reads corresponding to all other alleles for that taxon and locus:
where
B is the beta function, and is the overdispersion parameter set by
overdispersion.
is calculated by AddDepthSamplingPermutations.
A "RADdata" object identical to that passed to the function, but with
genotype likelihoods stored in object$genotypeLikelihood. This item is a
two dimensional list, with one row for each ploidy listed
in object$possiblePloidies, ignoring differences between
autopolyploids and allopolyploids, and one column for each ploidy listed in
object$taxaPloidy. Each item in the list is a three-dimensional
array with number of allele copies in the first dimension, taxa in the second dimension,
and alleles in the third dimension.
Lindsay V. Clark
# load example dataset and add allele frequency data(exampleRAD) exampleRAD <- AddAlleleFreqHWE(exampleRAD) # estimate genotype likelihoods exampleRAD <- AddGenotypeLikelihood(exampleRAD) # inspect the results # the first ten individuals and first two alleles, assuming diploidy exampleRAD$alleleDepth[1:10,1:2] exampleRAD$genotypeLikelihood[[1]][,1:10,1:2] # assuming tetraploidy exampleRAD$genotypeLikelihood[[2]][,1:10,1:2]# load example dataset and add allele frequency data(exampleRAD) exampleRAD <- AddAlleleFreqHWE(exampleRAD) # estimate genotype likelihoods exampleRAD <- AddGenotypeLikelihood(exampleRAD) # inspect the results # the first ten individuals and first two alleles, assuming diploidy exampleRAD$alleleDepth[1:10,1:2] exampleRAD$genotypeLikelihood[[1]][,1:10,1:2] # assuming tetraploidy exampleRAD$genotypeLikelihood[[2]][,1:10,1:2]
Given a "RADdata" object containing genotype prior probabilities
and genotype likelihoods, this function estimates genotype posterior
probabilities and adds them to the $posteriorProb slot of the object.
AddGenotypePosteriorProb(object, ...)AddGenotypePosteriorProb(object, ...)
object |
A |
... |
Potential future arguments (none currently in use). |
A "RADdata" object identical to that passed to the function, but
with a two-dimensional list added to the $posteriorProb slot. Rows of
the list correspont to object$possiblePloidies, and columns to unique
values in object$taxaPloidy, similarly to object$priorProb. Each
item of the list is a three dimensional array, with allele copy number in the
first dimension, taxa in the second dimension, and alleles in the third
dimension. For each allele and taxa, posterior probabilities will sum to one
across all potential allele copy numbers.
Lindsay V. Clark
AddGenotypeLikelihood,
AddGenotypePriorProb_Mapping2Parents
# load dataset and set some parameters data(exampleRAD_mapping) exampleRAD_mapping <- SetDonorParent(exampleRAD_mapping, "parent1") exampleRAD_mapping <- SetRecurrentParent(exampleRAD_mapping, "parent2") exampleRAD_mapping <- AddAlleleFreqMapping(exampleRAD_mapping, expectedFreqs = c(0.25, 0.75), allowedDeviation = 0.08) exampleRAD_mapping <- AddGenotypeLikelihood(exampleRAD_mapping) exampleRAD_mapping <- AddGenotypePriorProb_Mapping2Parents(exampleRAD_mapping, n.gen.backcrossing = 1) # estimate posterior probabilities exampleRAD_mapping <- AddGenotypePosteriorProb(exampleRAD_mapping) # examine the results exampleRAD_mapping$posteriorProb[[1,1]][,3,]# load dataset and set some parameters data(exampleRAD_mapping) exampleRAD_mapping <- SetDonorParent(exampleRAD_mapping, "parent1") exampleRAD_mapping <- SetRecurrentParent(exampleRAD_mapping, "parent2") exampleRAD_mapping <- AddAlleleFreqMapping(exampleRAD_mapping, expectedFreqs = c(0.25, 0.75), allowedDeviation = 0.08) exampleRAD_mapping <- AddGenotypeLikelihood(exampleRAD_mapping) exampleRAD_mapping <- AddGenotypePriorProb_Mapping2Parents(exampleRAD_mapping, n.gen.backcrossing = 1) # estimate posterior probabilities exampleRAD_mapping <- AddGenotypePosteriorProb(exampleRAD_mapping) # examine the results exampleRAD_mapping$posteriorProb[[1,1]][,3,]
Using local allele frequencies estimated by AddAlleleFreqByTaxa
and assuming Hardy-Weinberg Equilibruim or inbreeding on a local scale,
AddGenotypePriorProb_ByTaxa estimates prior genotype probabilities at
each taxon, allele, and possible ploidy. These are then stored in the
$priorProb slot of the "RADdata" object.
AddGenotypePriorProb_ByTaxa(object, ...) ## S3 method for class 'RADdata' AddGenotypePriorProb_ByTaxa(object, selfing.rate = 0, ...)AddGenotypePriorProb_ByTaxa(object, ...) ## S3 method for class 'RADdata' AddGenotypePriorProb_ByTaxa(object, selfing.rate = 0, ...)
object |
A |
selfing.rate |
A number ranging from zero to one indicating the frequency of self-fertilization in the species. |
... |
Additional arguments (none implemented). |
A "RADdata" object identical to that passed to the function, but with a
two-dimensional list added to the $priorProb slot. Each row in the list
corresponds to one ploidy in object$possiblePloidies, and each column
to a unique ploidy in object$taxaPloidy. Each item is a three-dimensional
array with
allele copy number in the first dimension, taxa in the second dimension, and
alleles in the third dimension. The values in the array are prior genotype
probabilities. Additionally, "taxon" is recorded in the
"priorType" attribute.
Lindsay V. Clark
AddGenotypePriorProb_HWE for equations used for genotype prior
probability estimation.
AddGenotypePriorProb_Mapping2Parents,
AddGenotypeLikelihood
# load data data(exampleRAD) # do PCA exampleRAD <- AddPCA(exampleRAD, nPcsInit = 3) # get allele frequencies exampleRAD <- AddAlleleFreqByTaxa(exampleRAD) # add prior probabilities exampleRAD <- AddGenotypePriorProb_ByTaxa(exampleRAD) exampleRAD$priorProb[[1,1]][,1,] exampleRAD$priorProb[[2,1]][,1,] exampleRAD$priorProb[[1,1]][,2,] exampleRAD$priorProb[[2,1]][,2,] exampleRAD$priorProb[[1,2]][,1,] # try it with inbreeding, for diploid samples only exampleRAD2 <- SubsetByTaxon(exampleRAD, GetTaxa(exampleRAD)[exampleRAD$taxaPloidy == 2]) exampleRAD2 <- AddGenotypePriorProb_ByTaxa(exampleRAD2, selfing.rate = 0.5) exampleRAD2$priorProb[[1,1]][,1,]# load data data(exampleRAD) # do PCA exampleRAD <- AddPCA(exampleRAD, nPcsInit = 3) # get allele frequencies exampleRAD <- AddAlleleFreqByTaxa(exampleRAD) # add prior probabilities exampleRAD <- AddGenotypePriorProb_ByTaxa(exampleRAD) exampleRAD$priorProb[[1,1]][,1,] exampleRAD$priorProb[[2,1]][,1,] exampleRAD$priorProb[[1,1]][,2,] exampleRAD$priorProb[[2,1]][,2,] exampleRAD$priorProb[[1,2]][,1,] # try it with inbreeding, for diploid samples only exampleRAD2 <- SubsetByTaxon(exampleRAD, GetTaxa(exampleRAD)[exampleRAD$taxaPloidy == 2]) exampleRAD2 <- AddGenotypePriorProb_ByTaxa(exampleRAD2, selfing.rate = 0.5) exampleRAD2$priorProb[[1,1]][,1,]
To estimate genotype posterior probabilities based on read depth alone, without
taking any population parameters into account, this function can be used to set
a uniform prior probability on all possible genotypes. This function is not
part of any pipeline but can be used for very rough and quick genotype
estimates, when followed by AddGenotypeLikelihood,
AddGenotypePosteriorProb, AddPloidyChiSq, and
GetWeightedMeanGenotypes or GetProbableGenotypes.
AddGenotypePriorProb_Even(object, ...)AddGenotypePriorProb_Even(object, ...)
object |
A |
... |
Additional arguments (none implemented). |
A “RADdata” object identical that passed to the function, but with data stored in one new slot:
priorProb |
A two-dimensional list of matrices, with rows corresponding
to |
Values in object$ploidyChiSq may not be particularly meaningful
under uniform priors.
Lindsay V. Clark
data(exampleRAD) exampleRAD <- AddGenotypePriorProb_Even(exampleRAD) exampleRAD$priorProb # finish protocol to get genotypes exampleRAD <- AddGenotypeLikelihood(exampleRAD) exampleRAD <- AddPloidyChiSq(exampleRAD) exampleRAD <- AddGenotypePosteriorProb(exampleRAD) genmat <- GetWeightedMeanGenotypes(exampleRAD) genmatdata(exampleRAD) exampleRAD <- AddGenotypePriorProb_Even(exampleRAD) exampleRAD$priorProb # finish protocol to get genotypes exampleRAD <- AddGenotypeLikelihood(exampleRAD) exampleRAD <- AddPloidyChiSq(exampleRAD) exampleRAD <- AddGenotypePosteriorProb(exampleRAD) genmat <- GetWeightedMeanGenotypes(exampleRAD) genmat
Assuming Hardy-Weinberg Equilibrium, this function uses allele frequencies
and possible ploidies stored in a “RADdata” object to estimate
genotype frequencies in the population, then stores these genotype
frequencies in the $priorProb slot. Inbreeding can also be simulated
using the selfing.rate argument.
AddGenotypePriorProb_HWE(object, ...) ## S3 method for class 'RADdata' AddGenotypePriorProb_HWE(object, selfing.rate = 0, ...)AddGenotypePriorProb_HWE(object, ...) ## S3 method for class 'RADdata' AddGenotypePriorProb_HWE(object, selfing.rate = 0, ...)
object |
A “RADdata” object that has had allele frequencies added with
|
selfing.rate |
A number ranging from zero to one indicating the frequency of self-fertilization in the species. |
... |
Additional arguments (none currently implemented). |
For an autopolyploid, or within one subgenome of an allopolyploid, genotype prior probabilities are estimated as:
where is the ploidy, is the copy number of a given allele,
and is the allele frequency in the population.
If the selfing rate is above zero and ploidy is even, genotype prior probabilities are adjusted according to Equation 6 of de Silva et al. (2005):
where is the selfing rate. is a matrix,
with each column representing the allele copy number from 0 to of a
parental genotype, and each row representing the allele copy number from 0 to
of a progeny genotype, and matrix elements representing the frequencies
of progeny after self-fertilization (each column summing to one).
A “RADdata” object identical that passed to the function, but with data stored in one new slot:
priorProb |
A two-dimensional list of matrices, with rows corresponding to
|
Lindsay V. Clark
De Silva, H. N., Hall, A. J., Rikkerink, E., and Fraser, L. G. (2005) Estimation of allele frequencies in polyploids under certain patterns of inheritance. Heredity 95, 327–334. doi:10.1038/sj.hdy.6800728
AddGenotypePriorProb_Mapping2Parents, AddGenotypeLikelihood,
AddGenotypePriorProb_ByTaxa
# load in an example dataset data(exampleRAD) # add allele frequencies exampleRAD <- AddAlleleFreqHWE(exampleRAD) # add inheritance modes exampleRAD$possiblePloidies <- list(2L, 4L, c(2L, 2L)) # estimate genotype prior probabilities exampleRAD <- AddGenotypePriorProb_HWE(exampleRAD) # examine results exampleRAD$alleleFreq exampleRAD$priorProb # try it with inbreeding, for diploids only exampleRAD2 <- SubsetByTaxon(exampleRAD, GetTaxa(exampleRAD)[exampleRAD$taxaPloidy == 2]) exampleRAD2 <- AddGenotypePriorProb_HWE(exampleRAD2, selfing.rate = 0.5) exampleRAD2$priorProb# load in an example dataset data(exampleRAD) # add allele frequencies exampleRAD <- AddAlleleFreqHWE(exampleRAD) # add inheritance modes exampleRAD$possiblePloidies <- list(2L, 4L, c(2L, 2L)) # estimate genotype prior probabilities exampleRAD <- AddGenotypePriorProb_HWE(exampleRAD) # examine results exampleRAD$alleleFreq exampleRAD$priorProb # try it with inbreeding, for diploids only exampleRAD2 <- SubsetByTaxon(exampleRAD, GetTaxa(exampleRAD)[exampleRAD$taxaPloidy == 2]) exampleRAD2 <- AddGenotypePriorProb_HWE(exampleRAD2, selfing.rate = 0.5) exampleRAD2$priorProb
EstimateParentalGenotypes estimates the most likely genotypes of two
parent taxa. Using those parental genotypes,
AddGenotypePriorProb_Mapping2Parents estimates expected genotype
frequencies for a population of progeny, which are added to the
"RADdata" object in the $priorProb slot.
AddGenotypePriorProb_Mapping2Parents(object, ...) ## S3 method for class 'RADdata' AddGenotypePriorProb_Mapping2Parents(object, donorParent = GetDonorParent(object), recurrentParent = GetRecurrentParent(object), n.gen.backcrossing = 0, n.gen.intermating = 0, n.gen.selfing = 0, minLikelihoodRatio = 10, ...) EstimateParentalGenotypes(object, ...) ## S3 method for class 'RADdata' EstimateParentalGenotypes(object, donorParent = GetDonorParent(object), recurrentParent = GetRecurrentParent(object), n.gen.backcrossing = 0, n.gen.intermating = 0, n.gen.selfing = 0, minLikelihoodRatio = 10, ...)AddGenotypePriorProb_Mapping2Parents(object, ...) ## S3 method for class 'RADdata' AddGenotypePriorProb_Mapping2Parents(object, donorParent = GetDonorParent(object), recurrentParent = GetRecurrentParent(object), n.gen.backcrossing = 0, n.gen.intermating = 0, n.gen.selfing = 0, minLikelihoodRatio = 10, ...) EstimateParentalGenotypes(object, ...) ## S3 method for class 'RADdata' EstimateParentalGenotypes(object, donorParent = GetDonorParent(object), recurrentParent = GetRecurrentParent(object), n.gen.backcrossing = 0, n.gen.intermating = 0, n.gen.selfing = 0, minLikelihoodRatio = 10, ...)
object |
A |
... |
Additional arguments, listed below, to be passed to the method for
|
donorParent |
A character string indicating which taxon is the donor parent. If backcrossing was not performed, it does not matter which was the donor or recurrent parent. |
recurrentParent |
A character string indicating which taxon is the recurrent parent. |
n.gen.backcrossing |
An integer, zero or greater, indicating how many generations of backcrossing to the recurrent parent were performed. |
n.gen.intermating |
An integer, zero or greater, indicating how many generations of intermating within the population were performed. (Values above one should not have an effect on the genotype priors that are output, i.e. genotype probabilities after one generation of random mating are identical to genotype probabilities after >1 generation of random mating, assuming no genetic drift or selection). |
n.gen.selfing |
An integer, zero or greater, indicating how many generations of selfing were performed. |
minLikelihoodRatio |
The minimum likelihood ratio for determining parental genotypes with
confidence, to be passed to |
AddGenotypePriorProb_Mapping2Parents examines the parental and progeny
ploidies stored in object$taxaPloidy and throws an error if they do not
meet expectations. In particular, all progeny must be the same ploidy, and that
must be the ploidy that would be expected if the parents produced normal gametes.
For example in an F1 cross, if one parent was diploid and the other tetraploid,
all progeny must be triploid. If both parents are tetraploid, all progeny must
be tetraploid.
The most likely genotypes for the two parents are estimated by
EstimateParentalGenotypes using
GetLikelyGen. If parental gentoypes don't match progeny allele
frequencies, the function attempts to correct the parental genotypes to the
most likely combination that matches the allele frequency.
For each ploidy being examined, F1 genotype probabilities are then calculated
by AddGenotypePriorProb_Mapping2Parents.
Genotype probabilities are updated for each backcrossing generation, then each
intermating generation, then each selfing generation.
The default, with n.gen.backcrossing = 0, n.gen.intermating = 0
and n.gen.selfing = 0, will simulate an F1 population. A BC1F2
population, for example, would have n.gen.backcrossing = 1,
n.gen.intermating = 0 and n.gen.selfing = 1. A typical F2
population would have n.gen.selfing = 1 and the other two parameters
set to zero. However, in a self-incompatible species where many F1 are
intermated to produce the F2, one would instead use
n.gen.intermating = 1 and set the other parameters to zero.
A "RADdata" object identical to that passed to the function, but with
data stored in three new slots:
priorProb |
A two-dimensional list of matrices, with rows corresponding to
|
likelyGeno_donor |
A matrix of the donor parent genotypes that were
used for estimating genotype prior probabilities. Formatted like the
output of |
likelyGeno_recurrent |
A matrix of the recurrent parent genotypes that were use for estimating gentoype prior probabilities. |
For the time being, in allopolyploids it is assumed that copies of an allele are distributed among as few isoloci as possible. For example, if an autotetraploid genotype had two copies of allele A and two copies of allele B, it is assumed to be AA BB rather than AB AB. This may be remedied in the future by examining distribution of genotype likelihoods.
Lindsay V. Clark
AddGenotypeLikelihood, AddGenotypePriorProb_HWE
# load dataset and set some parameters data(exampleRAD_mapping) exampleRAD_mapping <- SetDonorParent(exampleRAD_mapping, "parent1") exampleRAD_mapping <- SetRecurrentParent(exampleRAD_mapping, "parent2") exampleRAD_mapping <- AddAlleleFreqMapping(exampleRAD_mapping, expectedFreqs = c(0.25, 0.75), allowedDeviation = 0.08) exampleRAD_mapping <- AddGenotypeLikelihood(exampleRAD_mapping) # examine the dataset exampleRAD_mapping exampleRAD_mapping$alleleFreq # estimate genotype priors for a BC1 population exampleRAD_mapping <- AddGenotypePriorProb_Mapping2Parents(exampleRAD_mapping, n.gen.backcrossing = 1) exampleRAD_mapping$priorProb# load dataset and set some parameters data(exampleRAD_mapping) exampleRAD_mapping <- SetDonorParent(exampleRAD_mapping, "parent1") exampleRAD_mapping <- SetRecurrentParent(exampleRAD_mapping, "parent2") exampleRAD_mapping <- AddAlleleFreqMapping(exampleRAD_mapping, expectedFreqs = c(0.25, 0.75), allowedDeviation = 0.08) exampleRAD_mapping <- AddGenotypeLikelihood(exampleRAD_mapping) # examine the dataset exampleRAD_mapping exampleRAD_mapping$alleleFreq # estimate genotype priors for a BC1 population exampleRAD_mapping <- AddGenotypePriorProb_Mapping2Parents(exampleRAD_mapping, n.gen.backcrossing = 1) exampleRAD_mapping$priorProb
This function uses read depth ratios or posterior genotype probabilities
(the latter preferentially) as input data for principal components analysis.
The PCA scores are then stored in the $PCA slot of the
"RADdata" object.
AddPCA(object, ...) ## S3 method for class 'RADdata' AddPCA(object, nPcsInit = 10, maxR2changeratio = 0.05, minPcsOut = 1, ...)AddPCA(object, ...) ## S3 method for class 'RADdata' AddPCA(object, nPcsInit = 10, maxR2changeratio = 0.05, minPcsOut = 1, ...)
object |
A |
nPcsInit |
The number of principal component axes to initially calculate. |
maxR2changeratio |
This number determines how many principal component axes are retained. The
difference in |
minPcsOut |
The minimum number of PC axes to output, which can override
|
... |
Additional arguments to be passed to the |
The PPCA (probabalistic PCA) method from pcaMethods is used, due to the high missing data rate that is typical of genotyping-by-sequencing datasets.
A "RADdata" object identical to the one passed to the function, but with
a matrix added to the $PCA slot. This matrix contains PCA scores, with
taxa in rows, and PC axes in columns.
If you see the error
Error in if (rel_ch < threshold & count > 5) { :
missing value where TRUE/FALSE needed
try lowering nPcsInit.
Lindsay V. Clark
# load data data(exampleRAD) # do PCA exampleRAD <- AddPCA(exampleRAD, nPcsInit = 3) plot(exampleRAD$PCA[,1], exampleRAD$PCA[,2])# load data data(exampleRAD) # do PCA exampleRAD <- AddPCA(exampleRAD, nPcsInit = 3) plot(exampleRAD$PCA[,1], exampleRAD$PCA[,2])
This function is intended to help identify the correct inheritance mode for
each locus in a "RADdata" object. Expected genotype frequencies
are taken from object$priorProb. Observed genotype frequencies are
estimated from object$genotypeLikelihood, where each taxon has a
partial assignment to each genotype, proportional to genotype likelihoods.
A statistic is then estimated.
AddPloidyChiSq(object, ...) ## S3 method for class 'RADdata' AddPloidyChiSq(object, excludeTaxa = GetBlankTaxa(object), ...)AddPloidyChiSq(object, ...) ## S3 method for class 'RADdata' AddPloidyChiSq(object, excludeTaxa = GetBlankTaxa(object), ...)
object |
A |
excludeTaxa |
A character vector indicating names of taxa to exclude from calculations. |
... |
Additional arguments to be passed to other methods (none currently in use). |
Parents (in mapping populations) and blank taxa are automatically excluded from calculations.
Genotypes with zero prior probability would result in an infinite
A statistic and therefore are excluded from
the calculation. However, the total number of observations (total number
of taxa) remains the same, so that if there are many taxa with high
likelihood for a genotype with zero prior probability,
will be high.
A "RADdata" object identical to the one passed to the function,
but with a matrix added to the $ploidyChiSq
slot. This matrix has inheritance rows (matching object$priorProb) in
rows and alleles in columns. object$ploidyChiSq contains the
values.
Lindsay V. Clark
AddGenotypeLikelihood, AddPloidyLikelihood
# load dataset and set some parameters data(exampleRAD_mapping) exampleRAD_mapping <- SetDonorParent(exampleRAD_mapping, "parent1") exampleRAD_mapping <- SetRecurrentParent(exampleRAD_mapping, "parent2") exampleRAD_mapping <- AddAlleleFreqMapping(exampleRAD_mapping, expectedFreqs = c(0.25, 0.75), allowedDeviation = 0.08) exampleRAD_mapping <- AddGenotypeLikelihood(exampleRAD_mapping) exampleRAD_mapping <- AddGenotypePriorProb_Mapping2Parents(exampleRAD_mapping, n.gen.backcrossing = 1) # get chi-squared values exampleRAD_mapping <- AddPloidyChiSq(exampleRAD_mapping) # view chi-squared and p-values (diploid only) exampleRAD_mapping$ploidyChiSq# load dataset and set some parameters data(exampleRAD_mapping) exampleRAD_mapping <- SetDonorParent(exampleRAD_mapping, "parent1") exampleRAD_mapping <- SetRecurrentParent(exampleRAD_mapping, "parent2") exampleRAD_mapping <- AddAlleleFreqMapping(exampleRAD_mapping, expectedFreqs = c(0.25, 0.75), allowedDeviation = 0.08) exampleRAD_mapping <- AddGenotypeLikelihood(exampleRAD_mapping) exampleRAD_mapping <- AddGenotypePriorProb_Mapping2Parents(exampleRAD_mapping, n.gen.backcrossing = 1) # get chi-squared values exampleRAD_mapping <- AddPloidyChiSq(exampleRAD_mapping) # view chi-squared and p-values (diploid only) exampleRAD_mapping$ploidyChiSq
Given prior genotype probabilities, and a set of high-confidence
genotypes estimated with GetLikelyGen, this function
estimates the probability of observing that distribution of genotypes
and stores the probability in the $ploidyLikelihood slot of the
"RADdata" object.
AddPloidyLikelihood(object, ...) ## S3 method for class 'RADdata' AddPloidyLikelihood(object, excludeTaxa = GetBlankTaxa(object), minLikelihoodRatio = 50, ...)AddPloidyLikelihood(object, ...) ## S3 method for class 'RADdata' AddPloidyLikelihood(object, excludeTaxa = GetBlankTaxa(object), minLikelihoodRatio = 50, ...)
object |
A |
... |
Additional arguments to be passed to the method for |
excludeTaxa |
A character vector indicating taxa that should be excluded from calculations. |
minLikelihoodRatio |
A number, one or higher, to be passed to |
The purpose of this function is to estimate the correct inheritance mode for each locus. This function may be deleted in the future in favor of better alternatives.
A "RADdata" object identical to that passed to the function, but with
results added to the $ploidyLikelihood slot. This has one row for each
possible ploidy (each ploidy with data in $priorProb), and one column
for each allele. Each element of the matrix is the multinomial probability
of seeing that distribution of genotypes given the prior probabilities.
Lindsay V. Clark
##---- Should be DIRECTLY executable !! ---- ##-- ==> Define data, use random, ##-- or do help(data=index) for the standard data sets. ## The function is currently defined as function (object, ...) { UseMethod("AddPloidyLikelihood", object) }##---- Should be DIRECTLY executable !! ---- ##-- ==> Define data, use random, ##-- or do help(data=index) for the standard data sets. ## The function is currently defined as function (object, ...) { UseMethod("AddPloidyLikelihood", object) }
GetWeightedMeanGenotypes Can Be Run
This function is used internally by AddPCA,
AddAlleleFreqByTaxa, and the internal function .alleleFreq
to test whether GetWeightedMeanGenotypes can be run on a
"RADdata" object.
CanDoGetWeightedMeanGeno(object, ...)CanDoGetWeightedMeanGeno(object, ...)
object |
A |
... |
Additional arguments (none implemented). |
A single Boolean value. To be TRUE, object$posteriorProb must be
non-null, and either there must be only one possible ploidy, or
object$ploidyChiSq must be non-null.
Lindsay V. Clark
AddGenotypePosteriorProb, AddPloidyChiSq
data(exampleRAD) CanDoGetWeightedMeanGeno(exampleRAD) exampleRAD <- AddAlleleFreqHWE(exampleRAD) exampleRAD <- AddGenotypePriorProb_HWE(exampleRAD) exampleRAD <- AddGenotypeLikelihood(exampleRAD) exampleRAD <- AddPloidyChiSq(exampleRAD) exampleRAD <- AddGenotypePosteriorProb(exampleRAD) CanDoGetWeightedMeanGeno(exampleRAD)data(exampleRAD) CanDoGetWeightedMeanGeno(exampleRAD) exampleRAD <- AddAlleleFreqHWE(exampleRAD) exampleRAD <- AddGenotypePriorProb_HWE(exampleRAD) exampleRAD <- AddGenotypeLikelihood(exampleRAD) exampleRAD <- AddPloidyChiSq(exampleRAD) exampleRAD <- AddGenotypePosteriorProb(exampleRAD) CanDoGetWeightedMeanGeno(exampleRAD)
Based on mean read depth at blank and non-blank taxa, estimate sample
cross-contamination and add that information to the "RADdata"
object.
EstimateContaminationRate(object, ...) ## S3 method for class 'RADdata' EstimateContaminationRate(object, multiplier = 1, ...)EstimateContaminationRate(object, ...) ## S3 method for class 'RADdata' EstimateContaminationRate(object, multiplier = 1, ...)
object |
A |
multiplier |
A single numeric value, or a named numeric vector with one value per blank
taxon in |
... |
Additional arguments (none implemented). |
This function estimates sample cross-contamination assuming that the only
source of contamination is from adapter or sample spill-over between wells
during library preparation, or contamination among the libraries themselves.
If you anticipate a higher rate of contamination during DNA extraction before
library preparation, you may wish to increase the value using
SetContamRate.
It is important to set the contamination rate to a reasonably accurate value (i.e. the right order of magnitude) in order for polyRAD to be able to identify homozygotes that may otherwise appear heterozygous due to contamination.
A "RADdata" object identical to object but with the
"contamRate" attribute adjusted.
Lindsay V. Clark
# dataset for this example data(Msi01genes) # give the name of the taxon that is blank Msi01genes <- SetBlankTaxa(Msi01genes, "blank") # Fifteen libraries were done; blank is pooled over all of them, and # most other samples are pooled over two libraries. mymult <- 2/15 # estimate the contamination rate Msi01genes <- EstimateContaminationRate(Msi01genes, multiplier = mymult)# dataset for this example data(Msi01genes) # give the name of the taxon that is blank Msi01genes <- SetBlankTaxa(Msi01genes, "blank") # Fifteen libraries were done; blank is pooled over all of them, and # most other samples are pooled over two libraries. mymult <- 2/15 # estimate the contamination rate Msi01genes <- EstimateContaminationRate(Msi01genes, multiplier = mymult)
For a given taxon and allele, this function generates barplots showing read depth ratio, posterior mean genotype, genotype prior probabilities, genotype likelihoods, and genotype posterior probabilities. It is intended as a sanity check on genotype calling, as well as a means to visually demonstrate the concept of Bayesian genotype calling.
ExamineGenotype(object, ...) ## S3 method for class 'RADdata' ExamineGenotype(object, taxon, allele, pldindex = 1, ...)ExamineGenotype(object, ...) ## S3 method for class 'RADdata' ExamineGenotype(object, taxon, allele, pldindex = 1, ...)
object |
A |
taxon |
A single character string indicating the taxon to show. |
allele |
A single character string indicating the allele to show. |
pldindex |
An index of which inheritance mode to use within |
... |
Other arguments (none implemented). |
A barplot is generated. Invisibly, a list is returned:
alleleDepth |
Sequence read depth for the selected allele. |
antiAlleleDepth |
Sequence read depth for all other alleles at the locus. |
depthRatio |
Proportion of reads at this taxon and locus belonging to this allele. |
priorProb |
A vector of genotype prior probabilities. |
genotypeLikelhood |
A vector of genotype likelihoods. |
posteriorProb |
A vector of genotype posterior probabilities. |
postMean |
The posterior mean genotype on a scale of 0 to 1. |
Lindsay V. Clark
data(exampleRAD) exampleRAD <- IterateHWE(exampleRAD) eg <- ExamineGenotype(exampleRAD, "sample088", "loc1_T")data(exampleRAD) exampleRAD <- IterateHWE(exampleRAD) eg <- ExamineGenotype(exampleRAD, "sample088", "loc1_T")
exampleRAD and exampleRAD_mapping are two very small
simulated "RADdata" datasets for testing polyRAD
functions. Each has four loci. exampleRAD is a
natural population of 100 individuals with a mix of diploid and tetraploid
loci, with 80 individuals diploid and 20 individuals triploid.
exampleRAD_mapping is a diploid BC1 mapping population with two parents
and 100 progeny.
Msi01genes is a "RADdata" object with 585 taxa and 24 loci,
containing real data from Miscanthus sinensis, obtained by using
VCF2RADdata on the file Msi01genes.vcf. Most individuals
in Msi01genes are diploid, with three haploids and one triploid.
data(exampleRAD) data(exampleRAD_mapping) data(Msi01genes)data(exampleRAD) data(exampleRAD_mapping) data(Msi01genes)
See the format described in "RADdata".
Randomly generated using a script available in polyRAD/extdata/simulate_rad_data.R.
M. sinensis sequencing data available at https://www.ncbi.nlm.nih.gov//bioproject/PRJNA207721, with full genotype calls at doi:10.13012/B2IDB-1402948_V1.
data(exampleRAD) exampleRAD data(exampleRAD_mapping) exampleRAD_mapping data(Msi01genes) Msi01genesdata(exampleRAD) exampleRAD data(exampleRAD_mapping) exampleRAD_mapping data(Msi01genes) Msi01genes
These functions were created to help users determine an appropriate cutoff for
filtering loci based on after running
HindHe and InbreedingFromHindHe.
ExpectedHindHe takes allele frequencies, sample size, and read depths from
a RADdata object, simulates genotypes and allelic read depths from
these assuming Mendelian inheritance, and then estimates
for each simulated locus.
ExpectedHindHeMapping performs similar simulation and estimation, but
in mapping populations based on parental genotypes and expected distribution
of progeny genotypes.
SimGenotypes, SimGenotypesMapping, and
SimAlleleDepth are internal functions used by ExpectedHindHe
and ExpectedHindHeMapping
but are provided at the user level since they may be more broadly useful.
ExpectedHindHe(object, ploidy = object$possiblePloidies[[1]], inbreeding = 0, overdispersion = 20, contamRate = 0, errorRate = 0.001, reps = ceiling(5000/nLoci(object)), quiet = FALSE, plot = TRUE) ExpectedHindHeMapping(object, ploidy = object$possiblePloidies[[1]], n.gen.backcrossing = 0, n.gen.selfing = 0, overdispersion = 20, contamRate = 0, errorRate = 0.001, freqAllowedDeviation = 0.05, minLikelihoodRatio = 10, reps = ceiling(5000/nLoci(object)), quiet = FALSE, plot = TRUE) SimGenotypes(alleleFreq, alleles2loc, nsam, inbreeding, ploidy) SimGenotypesMapping(donorGen, recurGen, alleles2loc, nsam, ploidy.don, ploidy.rec, n.gen.backcrossing, n.gen.selfing) SimAlleleDepth(locDepth, genotypes, alleles2loc, overdispersion = 20, contamRate = 0, errorRate = 0.001)ExpectedHindHe(object, ploidy = object$possiblePloidies[[1]], inbreeding = 0, overdispersion = 20, contamRate = 0, errorRate = 0.001, reps = ceiling(5000/nLoci(object)), quiet = FALSE, plot = TRUE) ExpectedHindHeMapping(object, ploidy = object$possiblePloidies[[1]], n.gen.backcrossing = 0, n.gen.selfing = 0, overdispersion = 20, contamRate = 0, errorRate = 0.001, freqAllowedDeviation = 0.05, minLikelihoodRatio = 10, reps = ceiling(5000/nLoci(object)), quiet = FALSE, plot = TRUE) SimGenotypes(alleleFreq, alleles2loc, nsam, inbreeding, ploidy) SimGenotypesMapping(donorGen, recurGen, alleles2loc, nsam, ploidy.don, ploidy.rec, n.gen.backcrossing, n.gen.selfing) SimAlleleDepth(locDepth, genotypes, alleles2loc, overdispersion = 20, contamRate = 0, errorRate = 0.001)
object |
A |
ploidy |
A single integer indicating the ploidy to use for genotype simulation.
For |
inbreeding |
A number ranging from 0 to 1 indicating the amount of inbreeding ( |
overdispersion |
Overdispersion parameter as described in |
contamRate |
Sample cross-contamination rate to simulate. Although 0 is the default, 0.001 is also reasonable. |
errorRate |
Sequencing error rate to simulate. For Illumina reads, 0.001 is a reasonable value. An error is assumed to have an equal chance of converting an allele to any other allele at the locus, although this is somewhat of an oversimplification. |
reps |
The number of times to simulate the data and estimate |
quiet |
Boolean indicating whether to suppress messages and results printed to console. |
plot |
Boolean indicating whether to plot a histogram of |
n.gen.backcrossing |
An integer indicating the number of generations of backcrossing. |
n.gen.selfing |
An integer indicating the number of generations of self-fertilization. |
freqAllowedDeviation |
The amount by which allele frequencies are allowed to deviate from expected
allele frequencies. See |
minLikelihoodRatio |
Minimum likelihood ratio for determining the most likely parental genotypes.
See |
alleleFreq |
A vector of allele frequencies, as can be found in the |
alleles2loc |
An integer vector assigning alleles to loci, as can be found in the
|
nsam |
An integer indicating the number of samples (number of taxa) to simulate. |
donorGen |
A vector indicating genotypes of the donor parent (which can be either parent if backcrossing was not performed), with one value for each allele in the dataset, and numbers indicating the copy number of each allele. |
recurGen |
A vector indicating genotypes of the recurrent parent, as with |
ploidy.don |
A single integer indicating the ploidy of the donor parent. |
ploidy.rec |
A single integer indicating the ploidy of the recurrent parent. |
locDepth |
An integer matrix indicating read depth at each taxon and locus. Formatted as
the |
genotypes |
A numeric matrix, formatted as the output of |
To prevent highly inflated values in the output, ExpectedHindHe filters
loci with minor allele frequencies below five times the sequencing error rate.
ExpectedHindHe and ExpectedHindHeMapping invisibly return a
matrix, with loci in rows and reps in
columns, containing from the simulated loci.
SimGenotypes and SimGenotypesMapping return a numeric matrix of
allele copy number, with samples
in rows and alleles in columns, similar to that produced by
GetProbableGenotypes.
SimAlleleDepth returns an integer matrix of allelic read depth, with
samples in rows and alleles in columns, similar to the $alleleDepth
slot of a RADdata object.
Lindsay V. Clark
Clark, L. V., Mays, W., Lipka, A. E. and Sacks, E. J. (2022) A population-level statistic for assessing Mendelian behavior of genotyping-by-sequencing data from highly duplicated genomes. BMC Bioinformatics 23, 101, doi:10.1186/s12859-022-04635-9.
# Load dataset for the example data(exampleRAD) exampleRAD <- AddAlleleFreqHWE(exampleRAD) # Simulate genotypes simgeno <- SimGenotypes(exampleRAD$alleleFreq, exampleRAD$alleles2loc, 10, 0.2, 2) # Simulate reads simreads <- SimAlleleDepth(exampleRAD$locDepth[1:10,], simgeno, exampleRAD$alleles2loc) # Get expected Hind/He distribution if all loci in exampleRAD were well-behaved ExpectedHindHe(exampleRAD, reps = 10) # Mapping population example data(exampleRAD_mapping) exampleRAD_mapping <- SetDonorParent(exampleRAD_mapping, "parent1") exampleRAD_mapping <- SetRecurrentParent(exampleRAD_mapping, "parent2") exampleRAD_mapping <- AddAlleleFreqMapping(exampleRAD_mapping, expectedFreqs = c(0.25, 0.75), allowedDeviation = 0.08) exampleRAD_mapping <- AddGenotypeLikelihood(exampleRAD_mapping) exampleRAD_mapping <- EstimateParentalGenotypes(exampleRAD_mapping, n.gen.backcrossing = 1) simgenomap <- SimGenotypesMapping(exampleRAD_mapping$likelyGeno_donor[1,], exampleRAD_mapping$likelyGeno_recurrent[1,], exampleRAD_mapping$alleles2loc, nsam = 10, ploidy.don = 2, ploidy.rec = 2, n.gen.backcrossing = 1, n.gen.selfing = 0) ExpectedHindHeMapping(exampleRAD_mapping, n.gen.backcrossing = 1, reps = 10)# Load dataset for the example data(exampleRAD) exampleRAD <- AddAlleleFreqHWE(exampleRAD) # Simulate genotypes simgeno <- SimGenotypes(exampleRAD$alleleFreq, exampleRAD$alleles2loc, 10, 0.2, 2) # Simulate reads simreads <- SimAlleleDepth(exampleRAD$locDepth[1:10,], simgeno, exampleRAD$alleles2loc) # Get expected Hind/He distribution if all loci in exampleRAD were well-behaved ExpectedHindHe(exampleRAD, reps = 10) # Mapping population example data(exampleRAD_mapping) exampleRAD_mapping <- SetDonorParent(exampleRAD_mapping, "parent1") exampleRAD_mapping <- SetRecurrentParent(exampleRAD_mapping, "parent2") exampleRAD_mapping <- AddAlleleFreqMapping(exampleRAD_mapping, expectedFreqs = c(0.25, 0.75), allowedDeviation = 0.08) exampleRAD_mapping <- AddGenotypeLikelihood(exampleRAD_mapping) exampleRAD_mapping <- EstimateParentalGenotypes(exampleRAD_mapping, n.gen.backcrossing = 1) simgenomap <- SimGenotypesMapping(exampleRAD_mapping$likelyGeno_donor[1,], exampleRAD_mapping$likelyGeno_recurrent[1,], exampleRAD_mapping$alleles2loc, nsam = 10, ploidy.don = 2, ploidy.rec = 2, n.gen.backcrossing = 1, n.gen.selfing = 0) ExpectedHindHeMapping(exampleRAD_mapping, n.gen.backcrossing = 1, reps = 10)
After a "RADdata" object has been run through a pipeline such as
IteratePopStruct, these functions can be used to export
the genotypes to R packages and other software that can
perform genome-wide association and genomic prediction. ExportGAPIT,
Export_rrBLUP_Amat, Export_rrBLUP_GWAS, Export_GWASpoly,
and Export_TASSEL_Numeric all export continuous numerical genotypes
generated by GetWeightedMeanGenotypes. Export_polymapR,
Export_Structure, and Export_adegenet_genind use
GetProbableGenotypes to export discrete
genotypes. Export_MAPpoly and Export_polymapR_probs export
genotype posterior probabilities.
ExportGAPIT(object, onePloidyPerAllele = FALSE) Export_rrBLUP_Amat(object, naIfZeroReads = FALSE, onePloidyPerAllele = FALSE) Export_rrBLUP_GWAS(object, naIfZeroReads = FALSE, onePloidyPerAllele = FALSE) Export_TASSEL_Numeric(object, file, naIfZeroReads = FALSE, onePloidyPerAllele = FALSE) Export_polymapR(object, naIfZeroReads = TRUE, progeny = GetTaxa(object)[!GetTaxa(object) %in% c(GetDonorParent(object), GetRecurrentParent(object), GetBlankTaxa(object))]) Export_polymapR_probs(object, maxPcutoff = 0.9, correctParentalGenos = TRUE, multiallelic = "correct") Export_MAPpoly(object, file, pheno = NULL, ploidyIndex = 1, progeny = GetTaxa(object)[!GetTaxa(object) %in% c(GetDonorParent(object), GetRecurrentParent(object), GetBlankTaxa(object))], digits = 3) Export_GWASpoly(object, file, naIfZeroReads = TRUE, postmean = TRUE, digits = 3, splitByPloidy = TRUE) Export_Structure(object, file, includeDistances = FALSE, extraCols = NULL, missingIfZeroReads = TRUE) Export_adegenet_genind(object, ploidyIndex = 1)ExportGAPIT(object, onePloidyPerAllele = FALSE) Export_rrBLUP_Amat(object, naIfZeroReads = FALSE, onePloidyPerAllele = FALSE) Export_rrBLUP_GWAS(object, naIfZeroReads = FALSE, onePloidyPerAllele = FALSE) Export_TASSEL_Numeric(object, file, naIfZeroReads = FALSE, onePloidyPerAllele = FALSE) Export_polymapR(object, naIfZeroReads = TRUE, progeny = GetTaxa(object)[!GetTaxa(object) %in% c(GetDonorParent(object), GetRecurrentParent(object), GetBlankTaxa(object))]) Export_polymapR_probs(object, maxPcutoff = 0.9, correctParentalGenos = TRUE, multiallelic = "correct") Export_MAPpoly(object, file, pheno = NULL, ploidyIndex = 1, progeny = GetTaxa(object)[!GetTaxa(object) %in% c(GetDonorParent(object), GetRecurrentParent(object), GetBlankTaxa(object))], digits = 3) Export_GWASpoly(object, file, naIfZeroReads = TRUE, postmean = TRUE, digits = 3, splitByPloidy = TRUE) Export_Structure(object, file, includeDistances = FALSE, extraCols = NULL, missingIfZeroReads = TRUE) Export_adegenet_genind(object, ploidyIndex = 1)
object |
A |
onePloidyPerAllele |
Logical. If |
naIfZeroReads |
A logical indicating whether |
file |
A character string indicating a file path to which to write. |
pheno |
A data frame or matrix of phenotypic values, with progeny in rows and traits in columns. Columns should be named. |
ploidyIndex |
Index, within |
progeny |
A character vector indicating which individuals to export as progeny of the cross. |
maxPcutoff |
A cutoff for posterior probabilities, below which genotypes will be reported as 'NA' in the 'geno' column. |
correctParentalGenos |
Passed to |
multiallelic |
Passed to |
digits |
Number of decimal places to which to round genotype probabilities or posterior mean genotypes in the output file. |
postmean |
Logical. If |
splitByPloidy |
Logical. If |
includeDistances |
Logical. If |
extraCols |
An optional data frame, with one row per taxon, containing columns of data to output to the left of the genotypes in the Structure file. |
missingIfZeroReads |
See |
GAPIT, FarmCPU, rrBLUP, TASSEL, and GWASpoly allow
genotypes to be a continuous numeric variable. MAPpoly and polymapR
allow for import of genotype probabilities.
GAPIT does not allow missing data, hence there is no naIfZeroReads
argument for ExportGAPIT. Genotypes are exported on a scale of -1
to 1 for rrBLUP, on a scale of 0 to 2 for GAPIT and FarmCPU,
and on a scale of 0 to 1 for TASSEL.
For all functions except Export_Structure and Export_adegenet_genind,
one allele per marker is dropped. Export_MAPpoly
also drops alleles where one or both parental genotypes could not be determined,
and where both parents are homozygotes.
For ExportGAPIT
and Export_rrBLUP_GWAS, chromosome and position are filled with dummy
data if they do not exist in object$locTable. For Export_TASSEL_Numeric,
allele names are exported, but no chromosome or position information per se.
If the chromosomes in object$locTable are in character format,
ExportGAPIT, Export_MAPpoly, and Export_GWASpoly will
attempt to extract chromosome numbers.
For polymapR there must only be one possible inheritance mode across loci
(one value in object$possiblePloidies) in the RADdata object, although
triploid F1 populations derived from diploid and tetraploid parents are allowed.
See SubsetByPloidy for help reducing a RADdata object to a
single inheritance mode.
MAPpoly only
allows one ploidy, but Export_MAPpoly allows the user to select which
inheritance mode from the RADdata object to use. (This is due to how internal
polyRAD functions are coded.)
For ExportGAPIT, a list:
GD |
A data frame with taxa in the first column and alleles (markers)
in subsequent columns, containing the genotypes. To be passed to the |
GM |
A data frame with the name, chromosome number, and position of
every allele (marker). To be passed to the |
For Export_rrBLUP_Amat, a matrix with taxa in rows and alleles (markers)
in columns, containing genotype data. This can be passed to A.mat in
rrBLUP.
For Export_rrBLUP_GWAS, a data frame with alleles (markers) in rows.
The first three columns contain the marker names, chromosomes, and positions,
and the remaining columns each represent one taxon and contain the genotype
data. This can be passed to the GWAS function in rrBLUP.
Export_TASSEL_Numeric and Export_MAPpoly write a file but does
not return an object.
For Export_polymapR, a matrix of integers indicating the most probable
allele copy number, with markers in rows and individuals in columns. The
parents are listed first, followed by all progeny.
For Export_polymapR_probs, a data frame suitable to pass to the
probgeno_df argument of checkF1. Note that under
default parameters, in some cases the maxP, maxgeno, and
geno columns may not actually reflect the maximum posterior probability
if genotype correction was performed.
For Export_adegenet_genind, a "genind" object.
Export_MAPpoly, Export_GWASpoly, and Export_Structure
write files but do not return
an object. Files output by Export_GWASpoly are comma delimited and
in numeric format. Sample and locus names are included in the file output
by Export_Structure, and the number of rows for each sample is
equal to the highest ploidy as determined by the taxaPloidy slot and the
output of GetProbableGenotypes.
rrBLUP and polymapR are available through CRAN, and GAPIT and FarmCPU must be downloaded from the Zhang lab website. MAPpoly is available on GitHub but not yet on CRAN. GWASpoly is available from GitHub.
In my experience with TASSEL 5, numerical genotype files that are too large do
not load/display properly. If you run into this problem I recommend using
SplitByChromosome to split your RADdata object into
multiple smaller objects, which can then be exported to separate files using
Export_TASSEL_Numeric. If performing GWAS, you may also need to compute
a kinship matrix using separate software such as rrBLUP.
Lindsay V. Clark
GAPIT and FarmCPU:
Lipka, A. E., Tian, F., Wang, Q., Peiffer, J., Li, M., Bradbury, P. J., Gore, M. A., Buckler, E. S. and Zhang, Z. (2012) GAPIT: genome association and prediction integrated tool. Bioinformatics 28, 2397–2399.
Liu, X., Huang, M., Fan, B., Buckler, E. S., Zhang, Z. (2016) Iterative usage of fixed and random effects models for powerful and efficient genome-wide association studies. PLoS Genetics 12, e1005767.
rrBLUP:
Endelman, J.B. (2011) Ridge Regression and Other Kernels for Genomic Selection with R Package rrBLUP. The Plant Genome 4, 250–255.
TASSEL:
https://www.maizegenetics.net/tassel
Bradbury, P. J., Zhang, Z., Kroon, D. E., Casstevens, T. M., Ramdoss, Y. and Buckler, E. S. (2007) TASSEL: Software for association mapping of complex traits in diverse samples. Bioinformatics 23, 2633–2635.
polymapR:
Bourke, P., van Geest, G., Voorrips, R. E., Jansen, J., Kranenberg, T., Shahin, A., Visser, R. G. F., Arens, P., Smulders, M. J. M. and Maliepaard, C. (2018) polymapR: linkage analysis and genetic map construction from F1 populations of outcrossing polyploids. Bioinformatics 34, 3496–3502.
MAPpoly:
https://github.com/mmollina/MAPpoly
Mollinari, M. and Garcia, A. A. F. (2018) Linkage analysis and haplotype phasing in experimental autopolyploid populations with high ploidy level using hidden Markov models. bioRxiv doi: https://doi.org/10.1101/415232.
GWASpoly:
https://github.com/jendelman/GWASpoly
Rosyara, U. R., De Jong, W. S., Douches, D. S., and Endelman, J. B. (2016) Software for Genome-Wide Association Studies in Autopolyploids and Its Application to Potato. Plant Genome 9.
Structure:
https://web.stanford.edu/group/pritchardlab/structure.html
Hubisz, M. J., Falush, D., Stephens, M. and Pritchard, J. K. (2009) Inferring weak population structure with the assistance of sample group information. Molecular Ecology Resources 9, 1322–1332.
Falush, D., Stephens, M. and Pritchard, J. K. (2007) Inferences of population structure using multilocus genotype data: dominant markers and null alleles. Molecular Ecology Notes 7, 574–578
Falush, D., Stephens, M. and Pritchard, J. K. (2003) Inferences of population structure using multilocus genotype data: linked loci and correlated allele frequencies. Genetics 164, 1567–1587.
Pritchard, J. K., Stephens, M. and Donnelly, P. (2000) Inference of population structure using multilocus genotype data. Genetics 155, 945–959.
GetWeightedMeanGenotypes, RADdata2VCF
# load example dataset data(exampleRAD) # get genotype posterior probabilities exampleRAD <- IterateHWE(exampleRAD) # export to GAPIT exampleGAPIT <- ExportGAPIT(exampleRAD) # export to rrBLUP example_rrBLUP_A <- Export_rrBLUP_Amat(exampleRAD) example_rrBLUP_GWAS <- Export_rrBLUP_GWAS(exampleRAD) # export to TASSEL outfile <- tempfile() # temporary file for example Export_TASSEL_Numeric(exampleRAD, outfile) # for mapping populations data(exampleRAD_mapping) # specify donor and recurrent parents exampleRAD_mapping <- SetDonorParent(exampleRAD_mapping, "parent1") exampleRAD_mapping <- SetRecurrentParent(exampleRAD_mapping, "parent2") # run the pipeline exampleRAD_mapping <- PipelineMapping2Parents(exampleRAD_mapping) # convert to polymapR format examplePMR <- Export_polymapR(exampleRAD_mapping) examplePMR2 <- Export_polymapR_probs(exampleRAD_mapping) # export to MAPpoly outfile2 <- tempfile() # temporary file for example # generate a dummy phenotype matrix containing random numbers mypheno <- matrix(rnorm(200), nrow = 100, ncol = 2, dimnames = list(GetTaxa(exampleRAD_mapping)[-(1:2)], c("Height", "Yield"))) Export_MAPpoly(exampleRAD_mapping, file = outfile2, pheno = mypheno) # load data into MAPpoly # require(mappoly) # mydata <- read_geno_prob(outfile2) # export to GWASpoly outfile3 <- tempfile() # temporary file for example Export_GWASpoly(SubsetByPloidy(exampleRAD, list(2)), outfile3) # export to Structure outfile4 <- tempfile() # temporary file for example Export_Structure(exampleRAD, outfile4) # export to adegenet if(requireNamespace("adegenet", quietly = TRUE)){ mygenind <- Export_adegenet_genind(exampleRAD) }# load example dataset data(exampleRAD) # get genotype posterior probabilities exampleRAD <- IterateHWE(exampleRAD) # export to GAPIT exampleGAPIT <- ExportGAPIT(exampleRAD) # export to rrBLUP example_rrBLUP_A <- Export_rrBLUP_Amat(exampleRAD) example_rrBLUP_GWAS <- Export_rrBLUP_GWAS(exampleRAD) # export to TASSEL outfile <- tempfile() # temporary file for example Export_TASSEL_Numeric(exampleRAD, outfile) # for mapping populations data(exampleRAD_mapping) # specify donor and recurrent parents exampleRAD_mapping <- SetDonorParent(exampleRAD_mapping, "parent1") exampleRAD_mapping <- SetRecurrentParent(exampleRAD_mapping, "parent2") # run the pipeline exampleRAD_mapping <- PipelineMapping2Parents(exampleRAD_mapping) # convert to polymapR format examplePMR <- Export_polymapR(exampleRAD_mapping) examplePMR2 <- Export_polymapR_probs(exampleRAD_mapping) # export to MAPpoly outfile2 <- tempfile() # temporary file for example # generate a dummy phenotype matrix containing random numbers mypheno <- matrix(rnorm(200), nrow = 100, ncol = 2, dimnames = list(GetTaxa(exampleRAD_mapping)[-(1:2)], c("Height", "Yield"))) Export_MAPpoly(exampleRAD_mapping, file = outfile2, pheno = mypheno) # load data into MAPpoly # require(mappoly) # mydata <- read_geno_prob(outfile2) # export to GWASpoly outfile3 <- tempfile() # temporary file for example Export_GWASpoly(SubsetByPloidy(exampleRAD, list(2)), outfile3) # export to Structure outfile4 <- tempfile() # temporary file for example Export_Structure(exampleRAD, outfile4) # export to adegenet if(requireNamespace("adegenet", quietly = TRUE)){ mygenind <- Export_adegenet_genind(exampleRAD) }
For a single taxon in a "RADdata" object, GetLikelyGen
returns the most likely genotype (expressed in allele copy number) for each
allele and each possible ploidy. The likelihoods used for determining
genotypes are those stored in object$genotypeLikelihood.
GetLikelyGen(object, taxon, minLikelihoodRatio = 10)GetLikelyGen(object, taxon, minLikelihoodRatio = 10)
object |
A |
taxon |
A character string indicating the taxon for which genotypes should be returned. |
minLikelihoodRatio |
A number indicating the minimum ratio of the likelihood of the most likely genotype to the likelihood of the second-most likely genotype for any genotype to be output for a given allele. If this number is one or less, all of the most likely genotypes will be output regardless of likelihood ratio. Where filtering is required so that only high confidence genotypes are retained, this number should be increased. |
A matrix with ploidies in rows (named with ploidies converted to character format) and alleles in columns. Each value indicates the most likely number of copies of that allele that the taxon has, assuming that ploidy.
Lindsay V. Clark
# load dataset for this example data(exampleRAD) # add allele frequencies and genotype likelihoods exampleRAD <- AddAlleleFreqHWE(exampleRAD) exampleRAD <- AddGenotypeLikelihood(exampleRAD) # get most likely genotypes GetLikelyGen(exampleRAD, "sample001") GetLikelyGen(exampleRAD, "sample082") # try different filtering GetLikelyGen(exampleRAD, "sample001", minLikelihoodRatio = 1) GetLikelyGen(exampleRAD, "sample001", minLikelihoodRatio = 100)# load dataset for this example data(exampleRAD) # add allele frequencies and genotype likelihoods exampleRAD <- AddAlleleFreqHWE(exampleRAD) exampleRAD <- AddGenotypeLikelihood(exampleRAD) # get most likely genotypes GetLikelyGen(exampleRAD, "sample001") GetLikelyGen(exampleRAD, "sample082") # try different filtering GetLikelyGen(exampleRAD, "sample001", minLikelihoodRatio = 1) GetLikelyGen(exampleRAD, "sample001", minLikelihoodRatio = 100)
These functions calculate numerical genotype values using posterior
probabilities in a "RADdata" object, and output
those values as a matrix of taxa by alleles.
GetWeightedMeanGenotypes returns continuous genotype values,
weighted by posterior genotype probabilities (i.e. posterior mean
genotypes).
GetProbableGenotypes returns discrete genotype values indicating
the most probable genotype. If the "RADdata"
object includes more than one possible inheritance mode, the
$ploidyChiSq slot is used for selecting or weighting
inheritance modes for each allele.
GetWeightedMeanGenotypes(object, ...) ## S3 method for class 'RADdata' GetWeightedMeanGenotypes(object, minval = 0, maxval = 1, omit1allelePerLocus = TRUE, omitCommonAllele = TRUE, naIfZeroReads = FALSE, onePloidyPerAllele = FALSE, ...) GetProbableGenotypes(object, ...) ## S3 method for class 'RADdata' GetProbableGenotypes(object, omit1allelePerLocus = TRUE, omitCommonAllele = TRUE, naIfZeroReads = FALSE, correctParentalGenos = TRUE, multiallelic = "correct", ...)GetWeightedMeanGenotypes(object, ...) ## S3 method for class 'RADdata' GetWeightedMeanGenotypes(object, minval = 0, maxval = 1, omit1allelePerLocus = TRUE, omitCommonAllele = TRUE, naIfZeroReads = FALSE, onePloidyPerAllele = FALSE, ...) GetProbableGenotypes(object, ...) ## S3 method for class 'RADdata' GetProbableGenotypes(object, omit1allelePerLocus = TRUE, omitCommonAllele = TRUE, naIfZeroReads = FALSE, correctParentalGenos = TRUE, multiallelic = "correct", ...)
object |
A |
... |
Additional arguments, listed below, to be passed to the method for
|
minval |
The number that should be used for indicating that a taxon has zero copies of an allele. |
maxval |
The number that should be used for indicating that a taxon has the maximum copies of an allele (equal to the ploidy of the locus). |
omit1allelePerLocus |
A logical indicating whether one allele per locus should be omitted from the output, in order to reduce the number of variables and prevent singularities for genome-wide association and genomic prediction. The value for one allele can be predicted from the values from all other alleles at its locus. |
omitCommonAllele |
A logical, passed to the |
naIfZeroReads |
A logical indicating whether |
onePloidyPerAllele |
Logical. If |
correctParentalGenos |
Logical. If |
multiallelic |
A string indicating how to handle cases where allele copy number across all
alleles at a locus does not sum to the ploidy. To retain the most probable
copy number for each allele, even if they don't sum to the ploidy across
all alleles, use |
For each inheritance mode , taxon , allele , allele copy number
, total ploidy , and posterior genotype probability ,
posterior mean genotype is estimated by GetWeightedMeanGenotypes as:
For GetProbableGenotypes, the genotype is the one with the maximum posterior
probability:
When there are multiple inheritance modes and onePloidyPerAllele = FALSE,
the weighted genotype is estimated by GetWeightedMeanGenotypes as:
In GetProbableGenotypes, or GetWeightedMeanGenotypes
when there are multiple inheritance modes and onePloidyPerAllele = TRUE,
the genotype is simply the one corresponding to the inheritance mode with the minimum
value:
For GetWeightedMeanGenotypes,
a named matrix, with taxa in rows and alleles in columns,
and values ranging from minval to maxval.
These values can be treated as continuous genotypes.
For GetProbableGenotypes, a list:
genotypes |
A named integer matrix, with taxa in rows and alleles in columns, and values ranging from zero to the maximum ploidy for each allele. These values can be treated as discrete genotypes. |
ploidy_index |
A vector with one value per allele. It contains the index
of the most likely inheritance mode of that allele in
|
Lindsay V. Clark
# load dataset data(exampleRAD_mapping) # run a genotype calling pipeline; # substitute with any pipeline and parameters exampleRAD_mapping <- SetDonorParent(exampleRAD_mapping, "parent1") exampleRAD_mapping <- SetRecurrentParent(exampleRAD_mapping, "parent2") exampleRAD_mapping <- PipelineMapping2Parents(exampleRAD_mapping, n.gen.backcrossing = 1, useLinkage = FALSE) # get weighted mean genotypes wmg <- GetWeightedMeanGenotypes(exampleRAD_mapping) # examine the results wmg[1:10,] # get most probable genotypes pg <- GetProbableGenotypes(exampleRAD_mapping, naIfZeroReads = TRUE) # examine the results pg$genotypes[1:10,]# load dataset data(exampleRAD_mapping) # run a genotype calling pipeline; # substitute with any pipeline and parameters exampleRAD_mapping <- SetDonorParent(exampleRAD_mapping, "parent1") exampleRAD_mapping <- SetRecurrentParent(exampleRAD_mapping, "parent2") exampleRAD_mapping <- PipelineMapping2Parents(exampleRAD_mapping, n.gen.backcrossing = 1, useLinkage = FALSE) # get weighted mean genotypes wmg <- GetWeightedMeanGenotypes(exampleRAD_mapping) # examine the results wmg[1:10,] # get most probable genotypes pg <- GetProbableGenotypes(exampleRAD_mapping, naIfZeroReads = TRUE) # examine the results pg$genotypes[1:10,]
HindHe and HindHeMapping both generate a matrix of values, with
taxa in rows and loci in columns. The mean value of the matrix is expected to
be a certain value depending on the ploidy and, in the case of natural
populations and diversity panels, the inbreeding coefficient. colMeans
of the matrix can be used to filter non-Mendelian loci from the dataset.
rowMeans of the matrix can be used to identify taxa that are not the
expected ploidy, are interspecific hybrids, or are a mix of multiple samples.
HindHe(object, ...) ## S3 method for class 'RADdata' HindHe(object, omitTaxa = GetBlankTaxa(object), ...) HindHeMapping(object, ...) ## S3 method for class 'RADdata' HindHeMapping(object, n.gen.backcrossing = 0, n.gen.intermating = 0, n.gen.selfing = 0, ploidy = object$possiblePloidies[[1]], minLikelihoodRatio = 10, omitTaxa = c(GetDonorParent(object), GetRecurrentParent(object), GetBlankTaxa(object)), ...)HindHe(object, ...) ## S3 method for class 'RADdata' HindHe(object, omitTaxa = GetBlankTaxa(object), ...) HindHeMapping(object, ...) ## S3 method for class 'RADdata' HindHeMapping(object, n.gen.backcrossing = 0, n.gen.intermating = 0, n.gen.selfing = 0, ploidy = object$possiblePloidies[[1]], minLikelihoodRatio = 10, omitTaxa = c(GetDonorParent(object), GetRecurrentParent(object), GetBlankTaxa(object)), ...)
object |
A |
omitTaxa |
A character vector indicating names of taxa not to be included in the output.
For |
n.gen.backcrossing |
The number of generations of backcrossing performed in a mapping population. |
n.gen.intermating |
The number of generations of intermating performed in a mapping population.
Included for consistency with |
n.gen.selfing |
The number of generations of self-fertilization performed in a mapping population. |
ploidy |
A single value indicating the assumed ploidy to test. Currently, only autopolyploid and diploid inheritance modes are supported. |
minLikelihoodRatio |
Used internally by |
... |
Additional arguments (none implemented). |
These functions are especially useful for highly duplicated genomes, in which RAD tag alignments may have been incorrect, resulting in groups of alleles that do not represent true Mendelian loci. The statistic that is calculated is based on the principle that observed heterozygosity will be higher than expected heterozygosity if a "locus" actually represents two or more collapsed paralogs. However, the statistic uses read depth in place of genotypes, eliminating the need to perform genotype calling before filtering.
For a given taxon * locus, is the probability that two
sequencing reads, sampled without replacement, are different alleles (RAD tags).
In HindHe, is the expected heterozygosity, estimated from
allele frequencies by taking the column means of object$depthRatios.
This is also the estimated probability that if two alleles were sampled at
random from the population at a given locus, they would be different alleles.
In HindHeMapping, is the average probability that in
a random progeny, two alleles sampled without replacement would be different.
The number of generations of backcrossing and self-fertilization, along with the
ploidy and estimated parental genotypes, are needed to make this calculation.
The function essentially simulates the mapping population based on parental
genotypes to determine .
The expectation is that
in a diversity panel, where is the inbreeding coefficient, and
in a mapping population. Loci that have much higher average values likely represent collapsed paralogs that should be removed from the dataset. Taxa with much higher average values may be higher ploidy than expected, interspecific hybrids, or multiple samples mixed together.
A named matrix, with taxa in rows and loci in columns. For HindHeMapping,
loci are omitted if consistent parental genotypes could not be determined across
alleles.
Lindsay V. Clark
Clark, L. V., Mays, W., Lipka, A. E. and Sacks, E. J. (2022) A population-level statistic for assessing Mendelian behavior of genotyping-by-sequencing data from highly duplicated genomes. BMC Bioinformatics 23, 101, doi:10.1186/s12859-022-04635-9.
A seminar describing
is available at https://youtu.be/Z2xwLQYc8OA?t=1678.
InbreedingFromHindHe,
ExpectedHindHe
data(exampleRAD) hhmat <- HindHe(exampleRAD) colMeans(hhmat, na.rm = TRUE) # near 0.5 for diploid loci, 0.75 for tetraploid loci data(exampleRAD_mapping) exampleRAD_mapping <- SetDonorParent(exampleRAD_mapping, "parent1") exampleRAD_mapping <- SetRecurrentParent(exampleRAD_mapping, "parent2") hhmat2 <- HindHeMapping(exampleRAD_mapping, n.gen.backcrossing = 1) colMeans(hhmat2, na.rm = TRUE) # near 0.5; all loci diploiddata(exampleRAD) hhmat <- HindHe(exampleRAD) colMeans(hhmat, na.rm = TRUE) # near 0.5 for diploid loci, 0.75 for tetraploid loci data(exampleRAD_mapping) exampleRAD_mapping <- SetDonorParent(exampleRAD_mapping, "parent1") exampleRAD_mapping <- SetRecurrentParent(exampleRAD_mapping, "parent2") hhmat2 <- HindHeMapping(exampleRAD_mapping, n.gen.backcrossing = 1) colMeans(hhmat2, na.rm = TRUE) # near 0.5; all loci diploid
After running HindHe and examining the distribution of values
across taxa and loci, InbreedingFromHindHe can be used to estimate
the inbreeding statistic from the median or mode value of
. The statistic estimated encompasses inbreeding
from all sources, including population structure, self-fertilization, and
preferential mating among relatives. It is intended to be used as input to
the process_isoloci.py script.
InbreedingFromHindHe(hindhe, ploidy)InbreedingFromHindHe(hindhe, ploidy)
hindhe |
A value for |
ploidy |
A single integer indicating the ploidy of the population. |
A number indicating the inbreeding statistic . This is calculated as:
Lindsay V. Clark
HindHe, ExpectedHindHe,
readProcessSamMulti, readProcessIsoloci
InbreedingFromHindHe(0.5, 2) InbreedingFromHindHe(0.4, 2) InbreedingFromHindHe(0.5, 4)InbreedingFromHindHe(0.5, 2) InbreedingFromHindHe(0.4, 2) InbreedingFromHindHe(0.5, 4)
These are wrapper function that iteratively run other polyRAD functions until allele frequencies stabilize to within a user-defined threshold. Genotype posterior probabilities can then be exported for downstream analysis.
IterateHWE(object, selfing.rate = 0, tol = 1e-05, excludeTaxa = GetBlankTaxa(object), overdispersion = 9) IterateHWE_LD(object, selfing.rate = 0, tol = 1e-05, excludeTaxa = GetBlankTaxa(object), LDdist = 1e4, minLDcorr = 0.2, overdispersion = 9) IteratePopStruct(object, selfing.rate = 0, tol = 1e-03, excludeTaxa = GetBlankTaxa(object), nPcsInit = 10, minfreq = 0.0001, overdispersion = 9, maxR2changeratio = 0.05) IteratePopStructLD(object, selfing.rate = 0, tol = 1e-03, excludeTaxa = GetBlankTaxa(object), nPcsInit = 10, minfreq = 0.0001, LDdist = 1e4, minLDcorr = 0.2, overdispersion = 9, maxR2changeratio = 0.05)IterateHWE(object, selfing.rate = 0, tol = 1e-05, excludeTaxa = GetBlankTaxa(object), overdispersion = 9) IterateHWE_LD(object, selfing.rate = 0, tol = 1e-05, excludeTaxa = GetBlankTaxa(object), LDdist = 1e4, minLDcorr = 0.2, overdispersion = 9) IteratePopStruct(object, selfing.rate = 0, tol = 1e-03, excludeTaxa = GetBlankTaxa(object), nPcsInit = 10, minfreq = 0.0001, overdispersion = 9, maxR2changeratio = 0.05) IteratePopStructLD(object, selfing.rate = 0, tol = 1e-03, excludeTaxa = GetBlankTaxa(object), nPcsInit = 10, minfreq = 0.0001, LDdist = 1e4, minLDcorr = 0.2, overdispersion = 9, maxR2changeratio = 0.05)
object |
A |
selfing.rate |
A number ranging from zero to one indicating the frequency of self-fertilization in the species. For individuals with odd ploidy (e.g. triploids), the selfing rate is always treated as zero and a warning is printed if a value above zero is provided. |
tol |
A number indicating when the iteration should end. It indicates the maximum mean difference in allele frequencies between iterations that is tolerated. Larger numbers will lead to fewer iterations. |
excludeTaxa |
A character vector indicating names of taxa that should be excluded from allele frequency estimates and chi-squared estimates. |
nPcsInit |
An integer indicating the number of principal component axes to initially
estimate from |
minfreq |
A number indicating the minimum allele frequency allowed. Passed to
|
LDdist |
The distance, in basepairs, within which to search for alleles that may be in linkage disequilibrium with a given allele. |
minLDcorr |
The minimum correlation coefficient between two alleles
for linkage disequilibrium between those alleles to be used by the pipeline
for genotype estimation; see |
overdispersion |
Overdispersion parameter; see |
maxR2changeratio |
This number determines how many principal component axes are retained. The
difference in |
For IterateHWE, the following functions are run iteratively,
assuming no population structure:
AddAlleleFreqHWE,
AddGenotypePriorProb_HWE, AddGenotypeLikelihood,
AddPloidyChiSq, and AddGenotypePosteriorProb.
IterateHWE_LD runs each of the functions listed for IterateHWE
once, then runs AddAlleleLinkages. It then runs
AddAlleleFreqHWE, AddGenotypePriorProb_HWE,
AddGenotypePriorProb_LD, AddGenotypeLikelihood,
AddPloidyChiSq, and AddGenotypePosteriorProb
iteratively until allele frequencies converge.
For IteratePopStruct, the following functions are run iteratively,
modeling population structure:
AddPCA, AddAlleleFreqByTaxa,
AddAlleleFreqHWE, AddGenotypePriorProb_ByTaxa,
AddGenotypeLikelihood, AddPloidyChiSq, and
AddGenotypePosteriorProb.
After the first PCA analysis, the number of principal component axes is not
allowed to decrease, and can only increase by one from one round to the next,
in order to help the algorithm converge.
IteratePopStructLD runs each of the functions listed for
IteratePopStruct once, then runs AddAlleleLinkages.
It then runs
AddAlleleFreqHWE, AddGenotypePriorProb_ByTaxa,
AddGenotypePriorProb_LD,
AddGenotypeLikelihood, AddPloidyChiSq,
AddGenotypePosteriorProb, AddPCA,
and AddAlleleFreqByTaxa iteratively until convergence of
allele frequencies.
A "RADdata" object identical to that passed to the function, but with
$alleleFreq, $priorProb, $depthSamplingPermutations,
$genotypeLikelihood,
$ploidyChiSq, and $posteriorProb slots added.
For IteratePopStruct and IteratePopStructLD,
$alleleFreqByTaxa and $PCA are also added. For
IteratePopStructLD and IterateHWE_LD, $alleleLinkages
and $priorProbLD are also added.
If you see the error
Error in if (rel_ch < threshold & count > 5) { :
missing value where TRUE/FALSE needed
try lowering nPcsInit.
Lindsay V. Clark
GetWeightedMeanGenotypes for outputting genotypes in a
useful format after iteration is completed.
StripDown to remove memory-hogging slots that are no longer
needed after the pipeline has been run.
PipelineMapping2Parents for mapping populations.
# load dataset data(exampleRAD) # iteratively estimate parameters exampleRAD <- IterateHWE(exampleRAD) # export results GetWeightedMeanGenotypes(exampleRAD) # re-load to run pipeline assuming population structure data(exampleRAD) # run pipeline exampleRAD <- IteratePopStruct(exampleRAD, nPcsInit = 3) # export results GetWeightedMeanGenotypes(exampleRAD) # dataset for LD pipeline data(Msi01genes) # run HWE + LD pipeline mydata1 <- IterateHWE_LD(Msi01genes) # run pop. struct + LD pipeline # (tolerance raised to make example run faster) mydata2 <- IteratePopStructLD(Msi01genes, tol = 0.01)# load dataset data(exampleRAD) # iteratively estimate parameters exampleRAD <- IterateHWE(exampleRAD) # export results GetWeightedMeanGenotypes(exampleRAD) # re-load to run pipeline assuming population structure data(exampleRAD) # run pipeline exampleRAD <- IteratePopStruct(exampleRAD, nPcsInit = 3) # export results GetWeightedMeanGenotypes(exampleRAD) # dataset for LD pipeline data(Msi01genes) # run HWE + LD pipeline mydata1 <- IterateHWE_LD(Msi01genes) # run pop. struct + LD pipeline # (tolerance raised to make example run faster) mydata2 <- IteratePopStructLD(Msi01genes, tol = 0.01)
This function returns, and optionally prints, information about a single locus
with a RADdata object, including alignment position, allele
sequences, and genes overlapping the site.
LocusInfo(object, ...) ## S3 method for class 'RADdata' LocusInfo(object, locus, genome = NULL, annotation = NULL, verbose = TRUE, ...)LocusInfo(object, ...) ## S3 method for class 'RADdata' LocusInfo(object, locus, genome = NULL, annotation = NULL, verbose = TRUE, ...)
object |
A |
locus |
A character string indicating the name of the locus to display. Alternatively, a character string indicating the name of an allele, for which the corresponding locus will be identified. |
genome |
An optional |
annotation |
An optional |
verbose |
If |
... |
Additional arguments (none implemented). |
The locus name, allele names, and allele sequences are always returned (although
allele names are not printed with verbose). If the chromosome and
position are known, those are also returned and printed. If annotation
is provided, the function will return and print genes that overlap the locus.
If annotation and genome are provided, the function will attempt
to identify any amino acid changes caused by the alleles, using
predictCoding
internally. Identification of
amino acid changes will work if the RADdata object was created with
VCF2RADdata using the refgenome argument to fill in non-variable
sites, and/or if the alleles are only one nucleotide long.
A list containing:
Locus |
The name of the locus. |
Chromosome |
The chromosome name, if present. |
Position |
The position in base pairs on the chromosome, if present. |
Alleles |
Allele names for the locus. |
Haplotypes |
Allele sequences for the locus, in the same order. |
Frequencies |
Allele frequencies, if present, in the same order. |
Transcripts |
Transcripts overlapping the locus, if an annotation was provided but it wasn't possible to predict amino acid changes. |
PredictCoding |
The output of |
Lindsay V. Clark
data(exampleRAD) exampleRAD <- AddAlleleFreqHWE(exampleRAD) loc2info <- LocusInfo(exampleRAD, "loc2")data(exampleRAD) exampleRAD <- AddAlleleFreqHWE(exampleRAD) loc2info <- LocusInfo(exampleRAD, "loc2")
This function creates another function that can be used as a prefilter
by the function filterVcf in the package VariantAnnotation.
The user can set a minimum number of indiviuals with reads and a minimum
number of individuals with the minor allele (either the alternative or
reference allele). The filter can be used to generate a smaller VCF file
before reading with VCF2RADdata.
MakeTasselVcfFilter(min.ind.with.reads = 200, min.ind.with.minor.allele = 10)MakeTasselVcfFilter(min.ind.with.reads = 200, min.ind.with.minor.allele = 10)
min.ind.with.reads |
An integer indicating the minimum number of individuals that must have reads in order for a marker to be retained. |
min.ind.with.minor.allele |
An integer indicating the minimum number of individuals that must have the minor allele in order for a marker to be retained. |
This function assumes the VCF file was output by the TASSEL GBSv2 pipeline. This means that each genotype field begins with two digits ranging from zero to three separated by a forward slash to indicate the called genotype, followed by a colon.
A function is returned. The function takes as its only argument a character
vector representing a set of lines from a VCF file, with each line representing
one SNP. The function returns a logical vector the same length as the
character vector, with TRUE if the SNP meets the threshold for call rate
and minor allele frequency, and FALSE if it does not.
Lindsay V. Clark
https://bitbucket.org/tasseladmin/tassel-5-source/wiki/Tassel5GBSv2Pipeline
# make the filtering function filterfun <- MakeTasselVcfFilter(300, 15) # Executable code excluded from CRAN testing for taking >10 s: require(VariantAnnotation) # get the example VCF installed with polyRAD exampleVCF <- system.file("extdata", "Msi01genes.vcf", package = "polyRAD") exampleBGZ <- paste(exampleVCF, "bgz", sep = ".") # zip and index the file using Tabix (if not done already) if(!file.exists(exampleBGZ)){ exampleBGZ <- bgzip(exampleVCF) indexTabix(exampleBGZ, format = "vcf") } # make a temporary file # (for package checks; you don't need to do this in your own code) outfile <- tempfile(fileext = ".vcf") # filter to a new file filterVcf(exampleBGZ, destination = outfile, prefilters = FilterRules(list(filterfun)))# make the filtering function filterfun <- MakeTasselVcfFilter(300, 15) # Executable code excluded from CRAN testing for taking >10 s: require(VariantAnnotation) # get the example VCF installed with polyRAD exampleVCF <- system.file("extdata", "Msi01genes.vcf", package = "polyRAD") exampleBGZ <- paste(exampleVCF, "bgz", sep = ".") # zip and index the file using Tabix (if not done already) if(!file.exists(exampleBGZ)){ exampleBGZ <- bgzip(exampleVCF) indexTabix(exampleBGZ, format = "vcf") } # make a temporary file # (for package checks; you don't need to do this in your own code) outfile <- tempfile(fileext = ".vcf") # filter to a new file filterVcf(exampleBGZ, destination = outfile, prefilters = FilterRules(list(filterfun)))
If any alleles within a locus have identical alleleNucleotides values
(including those identical based on IUPAC ambiguity codes),
this function merges those alleles, summing their read depths. This function is
primarily intended to be used internally in cases where tags vary in length
within a locus, resulting in truncated alleleNucleotides.
MergeIdenticalHaplotypes(object, ...)MergeIdenticalHaplotypes(object, ...)
object |
A |
... |
Additional arguments (none implemented). |
A RADdata object identical to object, but with alleles merged.
Lindsay V. Clark
MergeRareHaplotypes, readProcessIsoloci
data(exampleRAD) # change a haplotype for this example exampleRAD$alleleNucleotides[5] <- "GY" nAlleles(exampleRAD) exampleRAD <- MergeIdenticalHaplotypes(exampleRAD) nAlleles(exampleRAD)data(exampleRAD) # change a haplotype for this example exampleRAD$alleleNucleotides[5] <- "GY" nAlleles(exampleRAD) exampleRAD <- MergeIdenticalHaplotypes(exampleRAD) nAlleles(exampleRAD)
MergeRareHaplotypes searches for rare alleles in a
"RADdata" object, and merges them into the most similar allele
at the same locus based on nucleotide sequence (or the most common allele if
multiple are equally similar). Read
depth is summed across merged alleles, and the alleleNucleotides slot
of the "RADdata" object contains IUPAC ambiguity codes to indicate
nucleotide differences across merged alleles. This function is designed to be
used immediately after data import.
MergeRareHaplotypes(object, ...) ## S3 method for class 'RADdata' MergeRareHaplotypes(object, min.ind.with.haplotype = 10, ...)MergeRareHaplotypes(object, ...) ## S3 method for class 'RADdata' MergeRareHaplotypes(object, min.ind.with.haplotype = 10, ...)
object |
A |
min.ind.with.haplotype |
The minimum number of taxa having reads from a given allele for that allele to not be merged. |
... |
Additional arguments; none implemented. |
Alleles with zero reads across the entire dataset are removed by
MergeRareHaplotypes without merging nucleotide sequences. After
merging, at least one allele is left, even if it has fewer than
min.ind.with.haplotype taxa with reads, as long as it has more than zero
taxa with reads.
A "RADdata" object identical to object, but with its
$alleleDepth, $antiAlleleDepth, $depthRatio,
$depthSamplingPermutations, $alleleNucleotides, and
$alleles2loc arguments adjusted after merging alleles.
Lindsay V. Clark
SubsetByLocus, VCF2RADdata, readStacks
data(exampleRAD) exampleRAD2 <- MergeRareHaplotypes(exampleRAD, min.ind.with.haplotype = 20) exampleRAD$alleleDepth[21:30,6:7] exampleRAD2$alleleDepth[21:30,6,drop=FALSE] exampleRAD$alleleNucleotides exampleRAD2$alleleNucleotidesdata(exampleRAD) exampleRAD2 <- MergeRareHaplotypes(exampleRAD, min.ind.with.haplotype = 20) exampleRAD$alleleDepth[21:30,6:7] exampleRAD2$alleleDepth[21:30,6,drop=FALSE] exampleRAD$alleleNucleotides exampleRAD2$alleleNucleotides
This function should be used in situations where data that were imported as separate taxa should be merged into a single taxon. The function should be used before any of the pipeline functions for genotype calling. Read depths are summed across duplicate taxa and output as a single taxon.
MergeTaxaDepth(object, ...) ## S3 method for class 'RADdata' MergeTaxaDepth(object, taxa, ...)MergeTaxaDepth(object, ...) ## S3 method for class 'RADdata' MergeTaxaDepth(object, taxa, ...)
object |
A |
taxa |
A character vector indicating taxa to be merged. The first taxon in the vector will be used to name the combined taxon in the output. |
... |
Additional arguments (none implemented). |
Examples of reasons to use this function:
Duplicate samples across different libraries were given different names so that preliminary analysis could confirm that they were truly the same (i.e. no mix-ups) before combining them.
Typos in the key file for the SNP mining software (TASSEL, Stacks, etc.) caused duplicate samples to have different names when they really should have had the same name.
To merge multiple sets of taxa into multiple combined taxa, this function can be run multiple times or in a loop.
A RADdata object derived from object. The alleleDepth,
antiAlleleDepth, locDepth, depthRatio, and
depthSamplingPermutation slots, and "taxa" and "nTaxa"
attributes, have been changed accordingly to reflect the merge.
Lindsay V. Clark
# dataset for this example data(exampleRAD) # merge the first three taxa into one exampleRADm <- MergeTaxaDepth(exampleRAD, c("sample001", "sample002", "sample003")) # inspect read depth exampleRAD$alleleDepth[1:3,] exampleRADm$alleleDepth[1:3,]# dataset for this example data(exampleRAD) # merge the first three taxa into one exampleRADm <- MergeTaxaDepth(exampleRAD, c("sample001", "sample002", "sample003")) # inspect read depth exampleRAD$alleleDepth[1:3,] exampleRADm$alleleDepth[1:3,]
This function exists primarily to be called by functions such as
AddPCA and GetWeightedMeanGenotypes
that may need to exclude one allele per locus to avoid mathematical
singularities. For a "RADdata" object, it returns
the indices of one allele per locus.
OneAllelePerMarker(object, ...) ## S3 method for class 'RADdata' OneAllelePerMarker(object, commonAllele = FALSE, ...)OneAllelePerMarker(object, ...) ## S3 method for class 'RADdata' OneAllelePerMarker(object, commonAllele = FALSE, ...)
object |
A |
commonAllele |
If |
... |
Additional arguments (none implemented). |
An integer vector indicating the index of one allele for each locus
in object.
Lindsay V. Clark
GetTaxa for a list of accessors.
data(exampleRAD) OneAllelePerMarker(exampleRAD) OneAllelePerMarker(exampleRAD, commonAllele = TRUE)data(exampleRAD) OneAllelePerMarker(exampleRAD) OneAllelePerMarker(exampleRAD, commonAllele = TRUE)
This function is a wrapper for AddAlleleFreqMapping,
AddGenotypeLikelihood,
AddGenotypePriorProb_Mapping2Parents,
AddPloidyChiSq, and AddGenotypePosteriorProb.
It covers the full pipeline for estimating genotype posterior probabilities
from read depth in a "RADdata" object containing data from
a mapping population.
PipelineMapping2Parents(object, n.gen.backcrossing = 0, n.gen.intermating = 0, n.gen.selfing = 0, minLikelihoodRatio = 10, freqAllowedDeviation = 0.05, freqExcludeTaxa = c(GetDonorParent(object), GetRecurrentParent(object), GetBlankTaxa(object)), useLinkage = TRUE, linkageDist = 1e7, minLinkageCorr = 0.5, overdispersion = 9)PipelineMapping2Parents(object, n.gen.backcrossing = 0, n.gen.intermating = 0, n.gen.selfing = 0, minLikelihoodRatio = 10, freqAllowedDeviation = 0.05, freqExcludeTaxa = c(GetDonorParent(object), GetRecurrentParent(object), GetBlankTaxa(object)), useLinkage = TRUE, linkageDist = 1e7, minLinkageCorr = 0.5, overdispersion = 9)
object |
A |
n.gen.backcrossing |
An integer, zero or greater, indicating how many generations of backcrossing to the recurrent parent were performed. |
n.gen.intermating |
An integer, zero or greater, indicating how many generations of intermating within the population were performed. |
n.gen.selfing |
An integer, zero or greater, indicating how many generations of selfing were performed. |
minLikelihoodRatio |
The minimum likelihood ratio for determining parental genotypes with
confidence, to be passed to |
freqAllowedDeviation |
For |
freqExcludeTaxa |
A character vector indicating taxa to exclude from allele frequency
estimates and ploidy |
useLinkage |
Boolean. Should genotypes at nearby loci (according to genomic alignment data) be used for updating genotype priors? |
linkageDist |
A number, in basepairs, indicating the maximum distance for linked loci.
Ignored if |
minLinkageCorr |
A number ranging from zero to one. Indicates the minimum correlation
coeffienct between weighted mean genotypes at two alleles in order for linkage
data to be used for updating genotype priors. Ignored if
|
overdispersion |
Overdispersion parameter; see |
Unlike IterateHWE and IteratePopStruct,
PipelineMapping2Parents only runs through each function once,
rather than iteratively until convergence.
A "RADdata" object identical to that passed to the function, with
the following slots added: $alleleFreq, depthSamplingPermutations,
$genotypeLikelihood,
likelyGeno_donor, likelyGeno_recurrent, $priorProb,
$ploidyChiSq, $posteriorProb, and if useLinkage = TRUE,
$alleleLinkages and $priorProbLD. See the documentation
for the functions listed in the description for more details on the
data contained in these slots.
Lindsay V. Clark
SetDonorParent and SetRecurrentParent to indicate which
individuals are the parents before running the function.
AddGenotypePriorProb_Mapping2Parents for how ploidy of parents and
progeny is interpreted.
GetWeightedMeanGenotypes or Export_polymapR for
exporting genotypes from the resulting object.
StripDown to remove memory-hogging slots that are no longer
needed after the pipeline has been run.
# load data for the example data(exampleRAD_mapping) # specify donor and recurrent parents exampleRAD_mapping <- SetDonorParent(exampleRAD_mapping, "parent1") exampleRAD_mapping <- SetRecurrentParent(exampleRAD_mapping, "parent2") # run the pipeline exampleRAD_mapping <- PipelineMapping2Parents(exampleRAD_mapping, n.gen.backcrossing = 1) # export results wmgeno <- GetWeightedMeanGenotypes(exampleRAD_mapping)[-(1:2),] wmgeno# load data for the example data(exampleRAD_mapping) # specify donor and recurrent parents exampleRAD_mapping <- SetDonorParent(exampleRAD_mapping, "parent1") exampleRAD_mapping <- SetRecurrentParent(exampleRAD_mapping, "parent2") # run the pipeline exampleRAD_mapping <- PipelineMapping2Parents(exampleRAD_mapping, n.gen.backcrossing = 1) # export results wmgeno <- GetWeightedMeanGenotypes(exampleRAD_mapping)[-(1:2),] wmgeno
RADdata is used internally to generate objects of the S3 class
“RADdata” by polyRAD functions for importing read depth data.
It is also available at the user level for cases where the data for import are
not already in a format supported by polyRAD.
RADdata(alleleDepth, alleles2loc, locTable, possiblePloidies, contamRate, alleleNucleotides, taxaPloidy) ## S3 method for class 'RADdata' plot(x, ...)RADdata(alleleDepth, alleles2loc, locTable, possiblePloidies, contamRate, alleleNucleotides, taxaPloidy) ## S3 method for class 'RADdata' plot(x, ...)
alleleDepth |
An integer matrix, with taxa in rows and alleles in columns. Taxa names should
be included as row names. Each value indicates the number of reads for a given
allele in a given taxon. There should be no |
alleles2loc |
An integer vector with one value for each column of |
locTable |
A data frame, where locus names are row names. There must be at least as
many rows as the highest value of |
possiblePloidies |
A list, where each item in the list is an integer vector (or a numeric vector
that can be converted to integer). Each vector indicates an inheritance
pattern that markers in the dataset might obey. |
contamRate |
A number ranging from zero to one (although in practice probably less than 0.01) indicating the expected sample cross-contamination rate. |
alleleNucleotides |
A character vector with one value for each column of
|
taxaPloidy |
An integer vector indicating ploidies of taxa. If a single value is provided,
it will be assumed that all taxa are the same ploidy. Otherwise, one value
must be provided for each taxon. If unnamed, it is assumed that taxa are in
the same order as the rows of |
x |
A “RADdata” object. |
... |
Additional arguments to pass to |
For a single locus, ideally the string provided in locTable$Ref and all
strings in alleleNucleotides are the same length, so that SNPs and indels
may be matched by position. The character “-” indicates a deletion with
respect to the reference, and can be used within alleleNucleotides. The
character “.” is a placeholder where other alleles have an insertion with
respect to the reference, and may be used in locTable$Ref and
alleleNucleotides. Note that it is possible for the sequence in
locTable$Ref to be absent from alleleNucleotides if the reference
haplotype is absent from the dataset, as may occur if the reference genome is that
of a related species and not the actual study species. For the
alleleNucleotides vector, the attribute "Variable_sites_only"
indicates whether non-variable sequence in between variants is included; this
needs to be FALSE for other functions to determine the position of each
variant within the set of tags.
Inheritance mode is determined by multiplying the values in
possiblePloidies by the values in taxaPloidy and dividing by two.
For example, if you wanted to assume autotetraploid inheritance across the
entire dataset, you could set possiblePloidies = list(4) and
taxaPloidy = 2, or alternatively possiblePloidies = list(2) and
taxaPloidy = 4. To indicate a mix of diploid and allotetraploid
inheritance across loci, set possiblePloidies = list(2, c(2, 2)) and
taxaPloidy = 2. If taxa themselves vary in ploidy, provide one
value of taxaPloidy for each taxon. All inheritance modes listed in
possiblePloidies apply equally to all taxa, even when ploidy varies
by taxon.
An object of the S3 class “RADdata”. The following slots are available
using the $ operator:
alleleDepth |
Identical to the argument provided to the function. |
alleles2loc |
Identical to the argument provided to the function. |
locTable |
Identical to the argument provided to the function. |
possiblePloidies |
The |
locDepth |
A matrix with taxa in rows and loci in columns, with read
depth summed across all alleles for each locus. Column names are locus
numbers rather than locus names. See |
depthSamplingPermutations |
A numeric matrix with taxa in rows and
alleles in columns. It is calculated as |
depthRatio |
A numeric matrix with taxa in rows and alleles in columns.
Calculated as |
antiAlleleDepth |
An integer matrix with taxa in rows and alleles in
columns. For each allele, the number of reads from the locus that do NOT
belong to that allele. Calculated as |
alleleNucleotides |
Identical to the argument provided to the function. |
taxaPloidy |
A named integer vector with one value per taxon, indicating the ploidy of taxa. |
The object additionally has several attributes (see attr):
taxa |
A character vector listing all taxa names, in the same order as
the rows of |
nTaxa |
An integer indicating the number of taxa. |
nLoc |
An integer indicating the number of loci in |
contamRate |
Identical to the argument provided to the function. |
The plot method performs a principal components analysis with
AddPCA if not already done, then plots the first two axes.
Points represent individuals (taxa). If mapping population parents have been
noted in the object (see SetDonorParent), they are indicated in
the plot.
Lindsay V. Clark
Data import functions that internally call RADdata:
readHMC, readTagDigger,
VCF2RADdata, readStacks,
readTASSELGBSv2, readProcessSamMulti,
readProcessIsoloci
# create the dataset mydepth <- matrix(sample(100, 16), nrow = 4, ncol = 4, dimnames = list(paste("taxon", 1:4, sep = ""), paste("loc", c(1,1,2,2), "_", c(0,1,0,1), sep = ""))) mydata <- RADdata(mydepth, c(1L,1L,2L,2L), data.frame(row.names = c("loc1", "loc2"), Chr = c(1,1), Pos = c(2000456, 5479880)), list(2, c(2,2)), 0.001, c("A", "G", "G", "T"), 6) # inspect the dataset mydata mydata$alleleDepth mydata$locDepth mydata$depthRatio mydata$taxaPloidy # the S3 class structure is flexible; other data can be added mydata$GPS <- data.frame(row.names = attr(mydata, "taxa"), Lat = c(43.12, 43.40, 43.05, 43.27), Long = -c(70.85, 70.77, 70.91, 70.95)) mydata$GPS # If you have NA in your alleleDepth matrix to indicate zero reads, # perform the following before running the RADdata constructor: mydepth[is.na(mydepth)] <- 0L # plotting a RADdata object plot(mydata)# create the dataset mydepth <- matrix(sample(100, 16), nrow = 4, ncol = 4, dimnames = list(paste("taxon", 1:4, sep = ""), paste("loc", c(1,1,2,2), "_", c(0,1,0,1), sep = ""))) mydata <- RADdata(mydepth, c(1L,1L,2L,2L), data.frame(row.names = c("loc1", "loc2"), Chr = c(1,1), Pos = c(2000456, 5479880)), list(2, c(2,2)), 0.001, c("A", "G", "G", "T"), 6) # inspect the dataset mydata mydata$alleleDepth mydata$locDepth mydata$depthRatio mydata$taxaPloidy # the S3 class structure is flexible; other data can be added mydata$GPS <- data.frame(row.names = attr(mydata, "taxa"), Lat = c(43.12, 43.40, 43.05, 43.27), Long = -c(70.85, 70.77, 70.91, 70.95)) mydata$GPS # If you have NA in your alleleDepth matrix to indicate zero reads, # perform the following before running the RADdata constructor: mydepth[is.na(mydepth)] <- 0L # plotting a RADdata object plot(mydata)
Converts genotype calls from polyRAD into VCF format. The user may send
the results directly to a file, or to a
CollapsedVCF for further manipulation.
RADdata2VCF(object, file = NULL, asSNPs = TRUE, hindhe = TRUE, sampleinfo = data.frame(row.names = GetTaxa(object)), contigs = data.frame(row.names = unique(object$locTable$Chr)))RADdata2VCF(object, file = NULL, asSNPs = TRUE, hindhe = TRUE, sampleinfo = data.frame(row.names = GetTaxa(object)), contigs = data.frame(row.names = unique(object$locTable$Chr)))
object |
A |
file |
An optional character string or connection indicating where to write the file. Append mode may be used with connections if multiple RADdata objects need to be written to one VCF. |
asSNPs |
Boolean indicating whether to convert haplotypes to individual SNPs and indels. |
hindhe |
Boolean indicating whether to export a mean value of Hind/He
(see |
sampleinfo |
A data frame with optional columns indicating any sample metadata to export to "SAMPLE" header lines. |
contigs |
A data frame with optional columns providing information about contigs to export to "contig" header lines. |
Currently, the FORMAT fields exported are GT (genotype), AD (allelic read depth), and DP (read depth). Genotype posterior probabilities are not exported due to the mathematical intractability of converting pseudo-biallelic probabilities to multiallelic probabilities.
Genotypes exported to the GT field are obtained internally using
GetProbableGenotypes.
INFO fields exported include the standard fields NS (number of samples with more than zero reads) and DP (total depth across samples) as well as the custom fields LU (index of the marker in the original RADdata object) and HH (Hind/He statistic for the marker).
This function requires the BioConductor package VariantAnnotation. See https://bioconductor.org/packages/release/bioc/html/VariantAnnotation.html for installation instructions.
A CollapsedVCF object.
Lindsay V. Clark
https://samtools.github.io/hts-specs/VCFv4.3.pdf
# Set up example dataset for export. # You DO NOT need to adjust attr or locTable in your own dataset. data(exampleRAD) attr(exampleRAD$alleleNucleotides, "Variable_sites_only") <- FALSE exampleRAD$locTable$Ref <- exampleRAD$alleleNucleotides[match(1:nLoci(exampleRAD), exampleRAD$alleles2loc)] exampleRAD <- IterateHWE(exampleRAD) # An optional table of sample data sampleinfo <- data.frame(row.names = GetTaxa(exampleRAD), Population = rep(c("North", "South"), each = 50)) # Add contig information (fill in with actual data rather than random) mycontigs <- data.frame(row.names = c("1", "4", "6", "9"), length = sample(1e8, 4), URL = rep("ftp://mygenome.com/mygenome.fa", 4)) # Set up a file destination for this example # (It is not necessary to use tempfile with your own data) outfile <- tempfile(fileext = ".vcf") # Export VCF testvcf <- RADdata2VCF(exampleRAD, file = outfile, sampleinfo = sampleinfo, contigs = mycontigs)# Set up example dataset for export. # You DO NOT need to adjust attr or locTable in your own dataset. data(exampleRAD) attr(exampleRAD$alleleNucleotides, "Variable_sites_only") <- FALSE exampleRAD$locTable$Ref <- exampleRAD$alleleNucleotides[match(1:nLoci(exampleRAD), exampleRAD$alleles2loc)] exampleRAD <- IterateHWE(exampleRAD) # An optional table of sample data sampleinfo <- data.frame(row.names = GetTaxa(exampleRAD), Population = rep(c("North", "South"), each = 50)) # Add contig information (fill in with actual data rather than random) mycontigs <- data.frame(row.names = c("1", "4", "6", "9"), length = sample(1e8, 4), URL = rep("ftp://mygenome.com/mygenome.fa", 4)) # Set up a file destination for this example # (It is not necessary to use tempfile with your own data) outfile <- tempfile(fileext = ".vcf") # Export VCF testvcf <- RADdata2VCF(exampleRAD, file = outfile, sampleinfo = sampleinfo, contigs = mycontigs)
Diversity Array Technologies (DArT)
provides a tag-based genotyping-by-sequencing service. Together with
Breeding Insight, a format was
developed indicting haplotype sequence and read depth, and that format is
imported by this function to make a RADdata object. The target
SNP and all off-target SNPs within the amplicon are imported as haplotypes.
Because the file format does not indicate strandedness of the tag, BLAST
results are used so that sequence and position are accurately stored in the
RADdata object. See the “extdata” folder of the polyRAD
installation for example files.
readDArTag(file, botloci = NULL, blastfile = NULL, excludeHaps = NULL, includeHaps = NULL, n.header.rows = 0, sample.name.row = 1, trim.sample.names = "_[^_]+_[ABCDEFGH][[:digit:]][012]?$", sep.counts = ",", sep.blast = "\t", possiblePloidies = list(2), taxaPloidy = 2L, contamRate = 0.001)readDArTag(file, botloci = NULL, blastfile = NULL, excludeHaps = NULL, includeHaps = NULL, n.header.rows = 0, sample.name.row = 1, trim.sample.names = "_[^_]+_[ABCDEFGH][[:digit:]][012]?$", sep.counts = ",", sep.blast = "\t", possiblePloidies = list(2), taxaPloidy = 2L, contamRate = 0.001)
file |
The file name of a spreadsheet from DArT indicating haplotype sequence and read depth. |
botloci |
A character vector indicating the names of loci for which the sequence is on the
bottom strand with respect to the reference genome. All other loci are assumed
to be on the top strand. Only one of |
blastfile |
File name for BLAST results for haplotypes. The file should be in tabular format
with |
excludeHaps |
Optional. Character vector with names of haplotypes (from the “AlleleID”
column) that should not be imported. Should not be used if |
includeHaps |
Optional. Character vector with names of haplotypes (from the “AlleleID”
column) that should be imported. Should not be used if |
n.header.rows |
Integer. The number of header rows in |
sample.name.row |
Integer. The row within |
trim.sample.names |
A regular expression indicating text to trim off of sample names. Use |
sep.counts |
The field separator character for |
sep.blast |
The field separator character for the BLAST results. The default assumes tab-delimited. |
possiblePloidies |
A list indicating possible inheritance modes. See |
taxaPloidy |
A single integer, or an integer vector with one value per taxon, indicating
ploidy. See |
contamRate |
Expected sample cross-contamination rate. See |
The “CloneID” column is used for locus names, and is assumed to contain
the chromosome (or scaffold) name and position, separated by an underscore.
The position is assumed to refer to the target SNP, which is identified by
comparing the “Ref_001” and “Alt_002” sequences. The position
is then converted to refer to the beginning of the tag (which may have been
reverse complemented depending on BLAST results), since additional SNPs may
be present. This facilitates accurate export to VCF using
RADdata2VCF.
Column names for the BLAST file can be “Query”, “Subject”, “S_start”, “S_end”, and “%Identity”, for compatibility with Breeding Insight formats.
A RADdata object ready for QC and genotype calling. Assuming
the “Ref_001” and “Alt_002” alleles were not excluded, the
locTable slot will include columns for chromosome, position, strand, and
reference sequence.
Lindsay V. Clark
https://www.diversityarrays.com/
readTagDigger, VCF2RADdata,
readStacks, readTASSELGBSv2,
readHMC
## Older Excellence in Breeding version # Example files installed with polyRAD dartfile <- system.file("extdata", "DArTag_example.csv", package = "polyRAD") blastfile <- system.file("extdata", "DArTag_BLAST_example.txt", package = "polyRAD") # One haplotype doesn't seem to have correct alignment (see BLAST results) exclude_hap <- c("Chr1_30668472|RefMatch_004") # Import data mydata <- readDArTag(dartfile, blastfile = blastfile, excludeHaps = exclude_hap, possiblePloidies = list(4), n.header.rows = 7, sample.name.row = 7) ## Newer Excellence in Breeding version (2022) # Example files installed with polyRAD dartfile <- system.file("extdata", "DArTag_example2.csv", package = "polyRAD") blastfile <- system.file("extdata", "DArTag_BLAST_example2.txt", package = "polyRAD") # One haplotype doesn't seem to have correct alignment (see BLAST results) exclude_hap <- c("Chr1_30668472|RefMatch_0004") # Import data mydata <- readDArTag(dartfile, blastfile = blastfile, excludeHaps = exclude_hap, possiblePloidies = list(4), n.header.rows = 0, sample.name.row = 1)## Older Excellence in Breeding version # Example files installed with polyRAD dartfile <- system.file("extdata", "DArTag_example.csv", package = "polyRAD") blastfile <- system.file("extdata", "DArTag_BLAST_example.txt", package = "polyRAD") # One haplotype doesn't seem to have correct alignment (see BLAST results) exclude_hap <- c("Chr1_30668472|RefMatch_004") # Import data mydata <- readDArTag(dartfile, blastfile = blastfile, excludeHaps = exclude_hap, possiblePloidies = list(4), n.header.rows = 7, sample.name.row = 7) ## Newer Excellence in Breeding version (2022) # Example files installed with polyRAD dartfile <- system.file("extdata", "DArTag_example2.csv", package = "polyRAD") blastfile <- system.file("extdata", "DArTag_BLAST_example2.txt", package = "polyRAD") # One haplotype doesn't seem to have correct alignment (see BLAST results) exclude_hap <- c("Chr1_30668472|RefMatch_0004") # Import data mydata <- readDArTag(dartfile, blastfile = blastfile, excludeHaps = exclude_hap, possiblePloidies = list(4), n.header.rows = 0, sample.name.row = 1)
This function reads the “HapMap.hmc.txt” and “HapMap.fas.txt” files output by the UNEAK pipeline and uses the data to generate a “RADdata” object.
readHMC(file, includeLoci = NULL, shortIndNames = TRUE, possiblePloidies = list(2), taxaPloidy = 2L, contamRate = 0.001, fastafile = sub("hmc.txt", "fas.txt", file, fixed = TRUE))readHMC(file, includeLoci = NULL, shortIndNames = TRUE, possiblePloidies = list(2), taxaPloidy = 2L, contamRate = 0.001, fastafile = sub("hmc.txt", "fas.txt", file, fixed = TRUE))
file |
Name of the file containing read depth (typically “HapMap.hmc.txt”). |
includeLoci |
An optional character vector of loci to be included in the output. |
shortIndNames |
Boolean. If TRUE, taxa names will be shortened with respect to those in the file, eliminating all text after and including the first underscore. |
possiblePloidies |
A list of numeric vectors indicating potential inheritance modes of SNPs in the
dataset. See |
taxaPloidy |
A single integer, or an integer vector with one value per taxon, indicating
ploidy. See |
contamRate |
A number ranging from zero to one (typically small) indicating the expected rate of sample cross-contamination. |
fastafile |
Name of the file containing tag sequences (typically “HapMap.fas.txt”). |
A RADdata object containing read depth, taxa and locus names, and
nucleotides at variable sites.
UNEAK is not able to report read depths greater than 127, which may be problematic for high depth data on polyploid organisms. The UNEAK pipeline is no longer being updated and is currently only available with archived versions of TASSEL.
Lindsay V. Clark
Lu, F., Lipka, A. E., Glaubitz, J., Elshire, R., Cherney, J. H., Casler, M. D., Buckler, E. S. and Costich, D. E. (2013) Switchgrass genomic diversity, ploidy, and evolution: novel insights from a network-based SNP discovery protocol. PLoS Genetics 9, e1003215.
https://www.maizegenetics.net/tassel
https://tassel.bitbucket.io/TasselArchived.html
readTagDigger, VCF2RADdata,
readStacks, readTASSELGBSv2,
readDArTag
# for this example we'll create dummy files rather than using real ones hmc <- tempfile() write.table(data.frame(rs = c("TP1", "TP2", "TP3"), ind1_merged_X3 = c("15|0", "4|6", "13|0"), ind2_merged_X3 = c("0|0", "0|1", "0|5"), HetCount_allele1 = c(0, 1, 0), HetCount_allele2 = c(0, 1, 0), Count_allele1 = c(15, 4, 13), Count_allele2 = c(0, 7, 5), Frequency = c(0, 0.75, 0.5)), row.names = FALSE, quote = FALSE, col.names = TRUE, sep = "\t", file = hmc) fas <- tempfile() writeLines(c(">TP1_query_64", "TGCAGAAAAAAAACGCTCGATGCCCCCTAATCCGTTTTCCCCATTCCGCTCGCCCCATCGGAGT", ">TP1_hit_64", "TGCAGAAAAAAAACGCTCGATGCCCCCTAATCCGTTTTCCCCATTCCGCTCGCCCCATTGGAGT", ">TP2_query_64", "TGCAGAAAAACAACACCCTAGGTAACAACCATATCTTATATTGCCGAATAAAAAACAACACCCC", ">TP2_hit_64", "TGCAGAAAAACAACACCCTAGGTAACAACCATATCTTATATTGCCGAATAAAAAATAACACCCC", ">TP3_query_64", "TGCAGAAAACATGGAGAGGGAGATGGCACGGCAGCACCACCGCTGGTCCGCTGCCCGTTTGCGG", ">TP3_hit_64", "TGCAGAAAACATGGAGATGGAGATGGCACGGCAGCACCACCGCTGGTCCGCTGCCCGTTTGCGG"), fas) # now read the data mydata <- readHMC(hmc, fastafile = fas) # inspect the results mydata mydata$alleleDepth mydata$alleleNucleotides row.names(mydata$locTable)# for this example we'll create dummy files rather than using real ones hmc <- tempfile() write.table(data.frame(rs = c("TP1", "TP2", "TP3"), ind1_merged_X3 = c("15|0", "4|6", "13|0"), ind2_merged_X3 = c("0|0", "0|1", "0|5"), HetCount_allele1 = c(0, 1, 0), HetCount_allele2 = c(0, 1, 0), Count_allele1 = c(15, 4, 13), Count_allele2 = c(0, 7, 5), Frequency = c(0, 0.75, 0.5)), row.names = FALSE, quote = FALSE, col.names = TRUE, sep = "\t", file = hmc) fas <- tempfile() writeLines(c(">TP1_query_64", "TGCAGAAAAAAAACGCTCGATGCCCCCTAATCCGTTTTCCCCATTCCGCTCGCCCCATCGGAGT", ">TP1_hit_64", "TGCAGAAAAAAAACGCTCGATGCCCCCTAATCCGTTTTCCCCATTCCGCTCGCCCCATTGGAGT", ">TP2_query_64", "TGCAGAAAAACAACACCCTAGGTAACAACCATATCTTATATTGCCGAATAAAAAACAACACCCC", ">TP2_hit_64", "TGCAGAAAAACAACACCCTAGGTAACAACCATATCTTATATTGCCGAATAAAAAATAACACCCC", ">TP3_query_64", "TGCAGAAAACATGGAGAGGGAGATGGCACGGCAGCACCACCGCTGGTCCGCTGCCCGTTTGCGG", ">TP3_hit_64", "TGCAGAAAACATGGAGATGGAGATGGCACGGCAGCACCACCGCTGGTCCGCTGCCCGTTTGCGG"), fas) # now read the data mydata <- readHMC(hmc, fastafile = fas) # inspect the results mydata mydata$alleleDepth mydata$alleleNucleotides row.names(mydata$locTable)
After process_isoloci.py is used to assign RAD tags to alignment locations
within a highly duplicated genome, readProcessIsoloci imports the
resulting CSV to a "RADdata" object.
readProcessIsoloci(sortedfile, min.ind.with.reads = 200, min.ind.with.minor.allele = 10, min.median.read.depth = 10, possiblePloidies = list(2), taxaPloidy = 2L, contamRate = 0.001, nameFromTagStart = TRUE, mergeRareHap = TRUE)readProcessIsoloci(sortedfile, min.ind.with.reads = 200, min.ind.with.minor.allele = 10, min.median.read.depth = 10, possiblePloidies = list(2), taxaPloidy = 2L, contamRate = 0.001, nameFromTagStart = TRUE, mergeRareHap = TRUE)
sortedfile |
File path to a CSV output by process_isoloci.py. |
min.ind.with.reads |
Minimum number of individuals with reads needed to retain a locus. |
min.ind.with.minor.allele |
Minimum number of individuals with reads in a minor allele needed to retain a locus. |
min.median.read.depth |
Minimum median read depth across individuals (including individuals with depth 0) needed to retain a locus. |
possiblePloidies |
A list indicating possible inheritance modes of loci. See |
taxaPloidy |
A single integer, or an integer vector with one value per taxon, indicating
ploidy. See |
contamRate |
Approximate rate of cross-contamination among samples. |
nameFromTagStart |
If |
mergeRareHap |
Boolean indicating whether to run |
MergeIdenticalHaplotypes is used internally by this function to
merge alleles with identical sequence for the region shared by all tags, in
cases where tags vary in length within a locus.
A "RADdata" object containing read depth and alignment positions
from sortedfile.
Lindsay V. Clark
This function imports the files output by process_sam_multi.py to a
"RADdata" object so that HindHe can be run to
filter samples and determine optimal parameters for process_isoloci.py.
readProcessSamMulti(alignfile, depthfile = sub("align", "depth", alignfile), expectedLoci = 1000, min.ind.with.reads = 200, min.ind.with.minor.allele = 10, possiblePloidies = list(2), taxaPloidy = 2L, contamRate = 0.001, expectedAlleles = expectedLoci * 15, maxLoci = expectedLoci)readProcessSamMulti(alignfile, depthfile = sub("align", "depth", alignfile), expectedLoci = 1000, min.ind.with.reads = 200, min.ind.with.minor.allele = 10, possiblePloidies = list(2), taxaPloidy = 2L, contamRate = 0.001, expectedAlleles = expectedLoci * 15, maxLoci = expectedLoci)
alignfile |
A file output by |
depthfile |
A file output by |
expectedLoci |
The number of loci expected in the final object. The default, 1000, is fairly small because this function is intended to be used for preliminary analysis only. |
min.ind.with.reads |
The minimum number of taxa with reads needed in order for a locus to be retained in the output. |
min.ind.with.minor.allele |
The minimum number of taxa with the same minor allele needed in order for a locus to be retained in the output. |
possiblePloidies |
A list indicating expected inheritance modes for markers. See
|
taxaPloidy |
A single integer, or an integer vector with one value per taxon, indicating
ploidy. See |
contamRate |
A number ranging from zero to one (although in practice probably less than 0.01) indicating the expected sample cross-contamination rate. |
expectedAlleles |
The expected number of alleles in the dataset. |
maxLoci |
The maximum number of loci to import before ceasing to read the file. Set to
|
A "RADdata" object.
Lindsay V. Clark
## Not run: myRAD <- readProcessSamMulti("mydata_2_align.csv") ## End(Not run)## Not run: myRAD <- readProcessSamMulti("mydata_2_align.csv") ## End(Not run)
Using the catalog files output by cstacks and matches file output by sstacks,
this function imports read depth into a RADdata object. If
genomic alignments were used, alignment data can optionally be imported.
readStacks(allelesFile, matchesFolder, version = '2.68', min.ind.with.reads = 200, min.ind.with.minor.allele = 10, readAlignmentData = FALSE, sumstatsFile = "populations.sumstats.tsv", possiblePloidies = list(2), taxaPloidy = 2L, contamRate = 0.001)readStacks(allelesFile, matchesFolder, version = '2.68', min.ind.with.reads = 200, min.ind.with.minor.allele = 10, readAlignmentData = FALSE, sumstatsFile = "populations.sumstats.tsv", possiblePloidies = list(2), taxaPloidy = 2L, contamRate = 0.001)
allelesFile |
Path to the "alleles" file from the Stacks catalog. |
matchesFolder |
Path to the folder containing "matches" files to import. |
version |
Either the string '1', '2', or '2.68', indicating the version of Stacks. File formats changed slightly between version 2.0 and version 2.68, so if you are using a version in between those you may need to try both and see which does not give an error. |
min.ind.with.reads |
For filtering loci. A locus must have at least this many samples with reads in order to be retained. |
min.ind.with.minor.allele |
For filtering loci. A locus must have at least this many samples with
reads for the minor allele in order to be retained. For loci with more
than two alleles, at least two alleles must be present in at least this
many individuals. This argument is also passed internally to the
|
readAlignmentData |
If |
sumstatsFile |
The name of the file containing summary statistics for loci. Ignored
unless |
possiblePloidies |
A list indicating possible inheritance modes in the dataset.
See |
taxaPloidy |
A single integer, or an integer vector with one value per taxon, indicating
ploidy. See |
contamRate |
A number from 0 to 1 (generally very small) indicating the expected rate of cross contamination between samples. |
A RADdata object.
This function has been tested with output from Stacks 1.47.
Lindsay V. Clark
Stacks website: http://catchenlab.life.illinois.edu/stacks/
Rochette, N. and Catchen, J. (2017) Deriving genotypes from RAD-seq short-read data using Stacks. Nature Protocols 12, 2640–2659.
Catchen, J., Hohenlohe, P. A., Bassham, S., Amores, A., and Cresko., W. A. (2013) Stacks: an analysis tool set for population genomics. Molecular Ecology 22, 3124–3140.
Catchen, J. M., Amores, A., Hohenlohe, P., Cresko, W., and Postlethwait, J. H. (2011) Stacks: building and genotyping loci de novo from short-read sequences. G3: Genes, Genomes, Genetics 1, 171–182.
VCF2RADdata, readTagDigger,
readHMC, readTASSELGBSv2,
readDArTag
## Not run: # Assuming the working directory contains the catalog and all matches files: myStacks <- readStacks("batch_1.catalog.alleles.tsv", ".", version = 1, readAlignmentData = TRUE) ## End(Not run)## Not run: # Assuming the working directory contains the catalog and all matches files: myStacks <- readStacks("batch_1.catalog.alleles.tsv", ".", version = 1, readAlignmentData = TRUE) ## End(Not run)
readTagDigger reads the CSV output containing read counts
from TagDigger and generates a "RADdata" object.
Optionally, it can also import a tag database generated by the
Tag Manager program within TagDigger, containing information
such as alignment position, to be stored in the $locTable
slot of the "RADdata" object.
readTagDigger(countfile, includeLoci = NULL, possiblePloidies = list(2), taxaPloidy = 2L, contamRate = 0.001, dbfile = NULL, dbColumnsToKeep = NULL, dbChrCol = "Chr", dbPosCol = "Pos", dbNameCol = "Marker name")readTagDigger(countfile, includeLoci = NULL, possiblePloidies = list(2), taxaPloidy = 2L, contamRate = 0.001, dbfile = NULL, dbColumnsToKeep = NULL, dbChrCol = "Chr", dbPosCol = "Pos", dbNameCol = "Marker name")
countfile |
Name of the file containing read counts. |
includeLoci |
An optional character vector containing names of loci to retain in the output. |
possiblePloidies |
A list of numeric vectors indicating potential inheritance modes of SNPs in the
dataset. See |
taxaPloidy |
A single integer, or an integer vector with one value per taxon, indicating
ploidy. See |
contamRate |
A number ranging from zero to one (typically small) indicating the expected rate of sample cross-contamination. |
dbfile |
Optionally, name of the Tag Manager database file. |
dbColumnsToKeep |
Optionally, a character vector indicating the names of columns to keep from the database file. |
dbChrCol |
The name of the column containing the chromosome number in the database file. |
dbPosCol |
The name of the column indicating alignment position in the database file. |
dbNameCol |
The name of the column containing marker names in the database file. |
Nucleotides associated with the alleles, to be stored in the
$alleleNucleotides slot, are extracted from the allele names in the
read counts file. It is assumed that the allele names first contain the
marker name, followed by an underscore, followed by the nucleotide(s) at
any variable positions.
A "RADdata" object.
Lindsay V. Clark
https://github.com/lvclark/tagdigger
Clark, L. V. and Sacks, E. J. (2016) TagDigger: User-friendly extraction of read counts from GBS and RAD-seq data. Source Code for Biology and Medicine 11, 11.
readHMC, readStacks, VCF2RADdata,
readTASSELGBSv2, readDArTag
# for this example we'll create dummy files countfile <- tempfile() write.csv(data.frame(row.names = c("Sample1", "Sample2", "Sample3"), Mrkr1_A_0 = c(0, 20, 4), Mrkr1_G_1 = c(7, 0, 12)), file = countfile, quote = FALSE) dbfile <- tempfile() write.csv(data.frame(Marker.name = "Mrkr1", Chr = 5, Pos = 66739827), file = dbfile, row.names = FALSE, quote = FALSE) # read the data myrad <- readTagDigger(countfile, dbfile = dbfile)# for this example we'll create dummy files countfile <- tempfile() write.csv(data.frame(row.names = c("Sample1", "Sample2", "Sample3"), Mrkr1_A_0 = c(0, 20, 4), Mrkr1_G_1 = c(7, 0, 12)), file = countfile, quote = FALSE) dbfile <- tempfile() write.csv(data.frame(Marker.name = "Mrkr1", Chr = 5, Pos = 66739827), file = dbfile, row.names = FALSE, quote = FALSE) # read the data myrad <- readTagDigger(countfile, dbfile = dbfile)
This function reads TagTaxaDist and SAM files output by the TASSEL 5 GBS v2
pipeline, and generates a RADdata object suitable for downstream
processing for genotype estimation. It elimintes the need to run the
DiscoverySNPCallerPluginV2 or the ProductionSNPCallerPluginV2, since
polyRAD operates on haplotypes rather than SNPs.
readTASSELGBSv2(tagtaxadistFile, samFile, min.ind.with.reads = 200, min.ind.with.minor.allele = 10, possiblePloidies = list(2), taxaPloidy = 2L, contamRate = 0.001, chromosomes = NULL)readTASSELGBSv2(tagtaxadistFile, samFile, min.ind.with.reads = 200, min.ind.with.minor.allele = 10, possiblePloidies = list(2), taxaPloidy = 2L, contamRate = 0.001, chromosomes = NULL)
tagtaxadistFile |
File name or path to a tab-delimited text file of read depth generated by the GetTagTaxaDistFromDBPlugin in TASSEL. |
samFile |
File name or path to the corresponding SAM file containing alignment information for the same set of tags. This file is obtained by running the TagExportToFastqPlugin in TASSEL, followed by alignment using Bowtie2 or BWA. |
min.ind.with.reads |
Integer used for marker filtering. The minimum number of individuals that must have read depth above zero for a locus to be retained in the output. |
min.ind.with.minor.allele |
Integer used for marker filtering. The minimum number of individuals
possessing reads for the minor allele for a locus to be retained in the output.
This value is also passed to the |
possiblePloidies |
A list indicating inheritance modes that might be encountered in the
dataset. See |
taxaPloidy |
A single integer, or an integer vector with one value per taxon, indicating
ploidy. See |
contamRate |
A number indicating the expected sample cross-contamination rate. See
|
chromosomes |
A character vector of chromosome names, indicating chromosomes to be retained
in the output. If |
A RADdata object containing read depth and alignment infomation from
the two input files.
Sequence tags must be identical in length to be assigned to the same locus by
this function. This is to prevent errors with
MergeRareHaplotypes.
Lindsay V. Clark
TASSEL GBSv2 pipeline: https://bitbucket.org/tasseladmin/tassel-5-source/wiki/Tassel5GBSv2Pipeline
Bowtie2: https://bowtie-bio.sourceforge.net/bowtie2/index.shtml
BWA: https://bio-bwa.sourceforge.net/
Other data import functions: readStacks, readHMC,
readTagDigger, VCF2RADdata,
readDArTag
# get files for this example samfile <- system.file("extdata", "exampleTASSEL_SAM.txt", package = "polyRAD") ttdfile <- system.file("extdata", "example_TagTaxaDist.txt", package = "polyRAD") # import data myrad <- readTASSELGBSv2(ttdfile, samfile, min.ind.with.reads = 8, min.ind.with.minor.allele = 2)# get files for this example samfile <- system.file("extdata", "exampleTASSEL_SAM.txt", package = "polyRAD") ttdfile <- system.file("extdata", "example_TagTaxaDist.txt", package = "polyRAD") # import data myrad <- readTASSELGBSv2(ttdfile, samfile, min.ind.with.reads = 8, min.ind.with.minor.allele = 2)
Whereas the reverseComplement function available in Biostrings only
functions on XString and XStringSet objects, the version in
polyRAD also works on character strings. It is written as an S4 method
in order to avoid conflict with Biostrings. It is primarily included for
internal use by polyRAD, but may be helpful at the user level as well.
reverseComplement(x, ...)reverseComplement(x, ...)
x |
A vector of character strings indicating DNA sequence using IUPAC codes. |
... |
Additional arguments (none implemented) |
A character vector.
Lindsay V. Clark
readDArTag uses this function internally.
reverseComplement(c("AAGT", "CCA"))reverseComplement(c("AAGT", "CCA"))
These functions are used for assigning and retrieving taxa from a
"RADdata" object that serve particular roles in the dataset.
Blank taxa can be used for estimating the contamination rate (see
EstimateContaminationRate), and the donor and recurrent parents
are used for determining
expected genotype distributions in mapping populations. Many functions
in polyRAD will automatically exclude taxa from analysis if they
have been assigned to one of these roles.
SetBlankTaxa(object, value) GetBlankTaxa(object, ...) SetDonorParent(object, value) GetDonorParent(object, ...) SetRecurrentParent(object, value) GetRecurrentParent(object, ...)SetBlankTaxa(object, value) GetBlankTaxa(object, ...) SetDonorParent(object, value) GetDonorParent(object, ...) SetRecurrentParent(object, value) GetRecurrentParent(object, ...)
object |
A |
value |
A character string (or a character vector for |
... |
Other arguments (none currently supported). |
For the “Get” functions, a character vector indicating the taxon or taxa
that have been assigned to that role. For the “Set” functions, a
"RADdata" object identical to the one passed to the function, but
with new taxa assigned to that role.
Lindsay V. Clark
AddGenotypePriorProb_Mapping2Parents
# assign parents in a mapping population data(exampleRAD_mapping) exampleRAD_mapping <- SetDonorParent(exampleRAD_mapping, "parent1") exampleRAD_mapping <- SetRecurrentParent(exampleRAD_mapping, "parent2") GetDonorParent(exampleRAD_mapping) GetRecurrentParent(exampleRAD_mapping) # assign blanks exampleRAD_mapping <- SetBlankTaxa(exampleRAD_mapping, c("progeny019", "progeny035")) GetBlankTaxa(exampleRAD_mapping)# assign parents in a mapping population data(exampleRAD_mapping) exampleRAD_mapping <- SetDonorParent(exampleRAD_mapping, "parent1") exampleRAD_mapping <- SetRecurrentParent(exampleRAD_mapping, "parent2") GetDonorParent(exampleRAD_mapping) GetRecurrentParent(exampleRAD_mapping) # assign blanks exampleRAD_mapping <- SetBlankTaxa(exampleRAD_mapping, c("progeny019", "progeny035")) GetBlankTaxa(exampleRAD_mapping)
This function is designed to be used after a RADdata object
has been processed by one of the pipeline functions.
Slots that are no longer needed are removed in order to conserve memory.
StripDown(object, ...) ## S3 method for class 'RADdata' StripDown(object, remove.slots = c("depthSamplingPermutations", "depthRatio", "antiAlleleDepth", "genotypeLikelihood", "priorProb", "priorProbLD"), ...)StripDown(object, ...) ## S3 method for class 'RADdata' StripDown(object, remove.slots = c("depthSamplingPermutations", "depthRatio", "antiAlleleDepth", "genotypeLikelihood", "priorProb", "priorProbLD"), ...)
object |
A |
remove.slots |
A character vector listing slots that will be removed. |
... |
Additional arguments (none implemented). |
The default slots that are removed take up a lot of memory but are not used
by the export functions. Other slots to consider removing are
alleleFreq, alleleFreqByTaxa, PCA, locDepth,
alleleDepth, and alleleLinkages. Of course, if you
have custom uses for some of the slots that are removed by default, you can
change the remove.slots vector to not include them.
The function will throw an error if the user attempts to remove key slots that are needed for export and downstream analysis, including:
alleles2loc
alleleNucleotides
locTable
possiblePloidies
ploidyChiSq
posteriorProb
A RADdata object
Lindsay V. Clark
# load a dataset for this example data(exampleRAD) # run a pipeline exampleRAD <- IterateHWE(exampleRAD) # check the size of the resulting object object.size(exampleRAD) # remove unneeded slots exampleRAD <- StripDown(exampleRAD) # check object size again object.size(exampleRAD)# load a dataset for this example data(exampleRAD) # run a pipeline exampleRAD <- IterateHWE(exampleRAD) # check the size of the resulting object object.size(exampleRAD) # remove unneeded slots exampleRAD <- StripDown(exampleRAD) # check object size again object.size(exampleRAD)
These functions take a RADdata object as input and generate smaller RADdata
objects containing only the specified loci. SubsetByLocus allows the
user to specify which loci are kept, whereas SplitByChromosome creates
multiple RADdata objects representing chromosomes or sets of chromosomes.
RemoveMonomorphicLoci eliminates any loci with fewer than two alleles.
RemoveHighDepthLoci eliminates loci that have especially high read
depth in order to eliminate false loci originating from repetitive sequence.
RemoveUngenotypedLoci is intended for datasets that have been run
through PipelineMapping2Parents and may have some genotypes that
are missing or non-variable due to how priors were determined.
SubsetByLocus(object, ...) ## S3 method for class 'RADdata' SubsetByLocus(object, loci, ...) SplitByChromosome(object, ...) ## S3 method for class 'RADdata' SplitByChromosome(object, chromlist = NULL, chromlist.use.regex = FALSE, fileprefix = "splitRADdata", ...) RemoveMonomorphicLoci(object, ...) ## S3 method for class 'RADdata' RemoveMonomorphicLoci(object, verbose = TRUE, ...) RemoveHighDepthLoci(object, ...) ## S3 method for class 'RADdata' RemoveHighDepthLoci(object, max.SD.above.mean = 2, verbose = TRUE, ...) RemoveUngenotypedLoci(object, ...) ## S3 method for class 'RADdata' RemoveUngenotypedLoci(object, removeNonvariant = TRUE, ...)SubsetByLocus(object, ...) ## S3 method for class 'RADdata' SubsetByLocus(object, loci, ...) SplitByChromosome(object, ...) ## S3 method for class 'RADdata' SplitByChromosome(object, chromlist = NULL, chromlist.use.regex = FALSE, fileprefix = "splitRADdata", ...) RemoveMonomorphicLoci(object, ...) ## S3 method for class 'RADdata' RemoveMonomorphicLoci(object, verbose = TRUE, ...) RemoveHighDepthLoci(object, ...) ## S3 method for class 'RADdata' RemoveHighDepthLoci(object, max.SD.above.mean = 2, verbose = TRUE, ...) RemoveUngenotypedLoci(object, ...) ## S3 method for class 'RADdata' RemoveUngenotypedLoci(object, removeNonvariant = TRUE, ...)
object |
A |
loci |
A character or numeric vector indicating which loci to include in the output
|
chromlist |
An optional list indicating how chromosomes should be split into separate
|
chromlist.use.regex |
If |
fileprefix |
A character string indicating the prefix of .RData files to export. |
max.SD.above.mean |
The maximum number of standard deviations above the mean read depth that a locus can be in order to be retained. |
verbose |
If |
removeNonvariant |
If |
... |
Additional arguments (none implemented). |
SubsetByLocus may be useful if the user has used their own filtering
criteria to determine a set of loci to retain, and wants to create a new
dataset with only those loci. It can be used at any point in the analysis
process.
SplitByChromosome is intended to make large datasets more manageable
by breaking them into smaller datasets that can be processed independently,
either in parallel computing jobs on a cluster, or one after another on a
computer with limited RAM. Generally it should be used immediately after
data import. Rather than returning new RADdata objects, it saves
them individually to separate workspace image files, which can than be
loaded one at a time to run analysis pipelines such as IteratePopStruct.
GetWeightedMeanGenotypes or one of the export functions can be
run on each resulting RADdata object, and the resulting matrices
concatenated with cbind.
SplitByChromosome, RemoveMonomorphicLoci, and
RemoveHighDepthLoci use SubsetByLocus internally.
SubsetByLocus, RemoveMonomorphicLoci,
RemoveHighDepthLoci, and RemoveUngenotypedLoci return a RADdata
object with all the slots and attributes of object, but only
containing the loci listed in loci, only loci with two or more
alleles, only loci without abnormally high depth, or only loci where posterior
probabilities are non-missing and variable, respectively.
SplitByChromosome returns a character vector containing file names
where .RData files have been saved. Each .RData file contains one
RADdata object named splitRADdata.
Lindsay V. Clark
# load a dataset for this example data(exampleRAD) exampleRAD # just keep the first and fourth locus subsetRAD <- SubsetByLocus(exampleRAD, c(1, 4)) subsetRAD # split by groups of chromosomes exampleRAD$locTable tf <- tempfile() splitfiles <- SplitByChromosome(exampleRAD, list(c(1, 4), c(6, 9)), fileprefix = tf) load(splitfiles[1]) splitRADdata # filter out monomorphic loci (none removed in example) filterRAD <- RemoveMonomorphicLoci(exampleRAD) # filter out high depth loci (none removed in this example) filterRAD2 <- RemoveHighDepthLoci(filterRAD) # filter out loci with missing or non-variable genotypes # (none removed in this example) filterRAD3 <- IterateHWE(filterRAD2) filterRAD3 <- RemoveUngenotypedLoci(filterRAD3)# load a dataset for this example data(exampleRAD) exampleRAD # just keep the first and fourth locus subsetRAD <- SubsetByLocus(exampleRAD, c(1, 4)) subsetRAD # split by groups of chromosomes exampleRAD$locTable tf <- tempfile() splitfiles <- SplitByChromosome(exampleRAD, list(c(1, 4), c(6, 9)), fileprefix = tf) load(splitfiles[1]) splitRADdata # filter out monomorphic loci (none removed in example) filterRAD <- RemoveMonomorphicLoci(exampleRAD) # filter out high depth loci (none removed in this example) filterRAD2 <- RemoveHighDepthLoci(filterRAD) # filter out loci with missing or non-variable genotypes # (none removed in this example) filterRAD3 <- IterateHWE(filterRAD2) filterRAD3 <- RemoveUngenotypedLoci(filterRAD3)
This function is used for removing some of the ploidies (i.e. inheritance modes
possible across loci)
stored in a RADdata object. If genotype calling has already
been performed, all of the relevant slots will be subsetted to only keep the
ploidies that the user indicates.
SubsetByPloidy(object, ...) ## S3 method for class 'RADdata' SubsetByPloidy(object, ploidies, ...)SubsetByPloidy(object, ...) ## S3 method for class 'RADdata' SubsetByPloidy(object, ploidies, ...)
object |
A |
ploidies |
A list, formatted like |
... |
Other arguments (none implemented). |
Note that slots of object are subsetted but not recalculated. For
example, GetWeightedMeanGenotypes takes a weighted mean across
ploidies, which is in turn used for estimating allele frequencies and
performing PCA. If the values in object$ploidyChiSq are considerably
higher for the ploidies being removed than for the ploidies being retained,
this difference is likely to be small and not substantially impact genotype
calling. Otherwise, it may be advisable to
re-run genotype calling after running SubsetByPloidy.
A RADdata object identical to object, but only containing data
relevant to the inheritance modes listed in ploidies.
If you only wish to retain taxa of a certain ploidy, instead do
object <- SubsetByTaxon(object, GetTaxaByPloidy(object, 4))
to, for example, only retain tetraploid taxa.
Lindsay V. Clark
# Example dataset assuming diploidy or autotetraploidy data(exampleRAD) exampleRAD <- IterateHWE(exampleRAD) # Subset to only keep tetraploid results exampleRAD <- SubsetByPloidy(exampleRAD, ploidies = list(4))# Example dataset assuming diploidy or autotetraploidy data(exampleRAD) exampleRAD <- IterateHWE(exampleRAD) # Subset to only keep tetraploid results exampleRAD <- SubsetByPloidy(exampleRAD, ploidies = list(4))
This function is used for removing some of the taxa from a dataset stored in a
RADdata object.
SubsetByTaxon(object, ...) ## S3 method for class 'RADdata' SubsetByTaxon(object, taxa, ...)SubsetByTaxon(object, ...) ## S3 method for class 'RADdata' SubsetByTaxon(object, taxa, ...)
object |
A |
taxa |
A character or numeric vector indicating which taxa to retain in the output. |
... |
Additional arguments (none implemented). |
This function may be used for subsetting a RADdata object either
immediately after data import, or after additional analysis has been
performed. Note however that estimation of allele frequencies, genotype
prior probabilities, PCA, etc. are very dependent on what samples
are included in the dataset. If those calculations have already been
performed, the results will be transferred to the new object but not
recalculated.
A RADdata object containing only the taxa listed in taxa.
Lindsay V. Clark
# load data for this example data(exampleRAD) exampleRAD # just keep the first fifty taxa subsetRAD <- SubsetByTaxon(exampleRAD, 1:50) subsetRAD# load data for this example data(exampleRAD) exampleRAD # just keep the first fifty taxa subsetRAD <- SubsetByTaxon(exampleRAD, 1:50) subsetRAD
This function is intended to help the user select a value to pass to the
overdispersion argument of AddGenotypeLikelihood,
generally via pipeline functions such as IterateHWE or
PipelineMapping2Parents.
TestOverdispersion(object, ...) ## S3 method for class 'RADdata' TestOverdispersion(object, to_test = seq(6, 20, by = 2), ...)TestOverdispersion(object, ...) ## S3 method for class 'RADdata' TestOverdispersion(object, to_test = seq(6, 20, by = 2), ...)
object |
A |
to_test |
A vector containing values to test. These are values that will potentially
be used for the |
... |
Additional arguments (none implemented). |
If no genotype calling has been performed, a single iteration under HWE using
default parameters will be done. object$ploidyChiSq is then examined
to determine the most common/most likely inheritance mode for the whole
dataset. The alleles that are examined are only those where this
inheritance mode has the lowest chi-squared value.
Within this inheritance mode and allele set, genotypes are selected where the
posterior probability of having a single copy of the allele is at least 0.95.
Read depth for these genotypes is then analyzed. For each genotype, a
two-tailed probability is calculated for the read depth ratio to deviate from
the expected ratio by at least that much under the beta-binomial distribution.
This test is performed for each overdispersion value provided in
to_test.
A list of the same length as to_test plus one. The names of the list are
to_test converted to a character vector. Each item in the list is a
vector of p-values, one per examined genotype, of the read depth ratio for
that genotype to deviate that much from the expected ratio. The last item,
named "optimal", is a single number indicating the optimal value for the
overdispersion parameter based on the p-value distributions. If the optimal
value was the minimum or maximum tested, NA is returned in the
"optimal" slot to encourage the user to test other values.
Lindsay V. Clark
# dataset with overdispersion data(Msi01genes) # test several values for the overdispersion parameter myP <- TestOverdispersion(Msi01genes, to_test = 8:10) # view results as quantiles sapply(myP[names(myP) != "optimal"], quantile, probs = c(0.01, 0.25, 0.5, 0.75, 0.99))# dataset with overdispersion data(Msi01genes) # test several values for the overdispersion parameter myP <- TestOverdispersion(Msi01genes, to_test = 8:10) # view results as quantiles sapply(myP[names(myP) != "optimal"], quantile, probs = c(0.01, 0.25, 0.5, 0.75, 0.99))
This function reads a Variant Call Format (VCF) file containing allelic read depth
and SNP alignment positions, such as can be produced by TASSEL or GATK, and
generates a RADdata dataset to be used for genotype calling in
polyRAD.
VCF2RADdata(file, phaseSNPs = TRUE, tagsize = 80, refgenome = NULL, tol = 0.01, al.depth.field = "AD", min.ind.with.reads = 200, min.ind.with.minor.allele = 10, possiblePloidies = list(2), taxaPloidy = 2L, contamRate = 0.001, samples = VariantAnnotation::samples(VariantAnnotation::scanVcfHeader(file)), svparam = VariantAnnotation::ScanVcfParam(fixed = "ALT", info = NA, geno = al.depth.field, samples = samples), yieldSize = 5000, expectedAlleles = 5e+05, expectedLoci = 1e+05, maxLoci = NA)VCF2RADdata(file, phaseSNPs = TRUE, tagsize = 80, refgenome = NULL, tol = 0.01, al.depth.field = "AD", min.ind.with.reads = 200, min.ind.with.minor.allele = 10, possiblePloidies = list(2), taxaPloidy = 2L, contamRate = 0.001, samples = VariantAnnotation::samples(VariantAnnotation::scanVcfHeader(file)), svparam = VariantAnnotation::ScanVcfParam(fixed = "ALT", info = NA, geno = al.depth.field, samples = samples), yieldSize = 5000, expectedAlleles = 5e+05, expectedLoci = 1e+05, maxLoci = NA)
file |
The path to a VCF file to be read. This can be uncompressed, bgzipped using
Samtools or Bioconductor, or a |
phaseSNPs |
If |
tagsize |
The read length, minus any barcode sequence, that was used for genotyping. In TASSEL,
this is the same as the kmerLength option. This argument is used for grouping
SNPs into haplotypes and is ignored if |
refgenome |
Optional. The name of a FASTA file, or an |
tol |
The proportion by which two SNPs can differ in read depth and still be merged
into one group for phasing. Ignored if |
al.depth.field |
The name of the genotype field in the VCF file that contains read depth at each allele. This should be "AD" unless your format is very unusual. |
min.ind.with.reads |
Integer used for filtering SNPs. To be retained, a SNP must have at least this many samples with reads. |
min.ind.with.minor.allele |
Integer used for filtering SNPs. To be retained, a SNP must have at least this many samples with the minor allele. When there are more than two alleles, at least two alleles must have at least this many samples with reads for the SNP to be retained. |
possiblePloidies |
A list indicating inheritance modes that might be encountered in the
dataset. See |
taxaPloidy |
A single integer, or an integer vector with one value per taxon, indicating
ploidy. See |
contamRate |
A number indicating the expected sample cross-contamination rate. See
|
samples |
A character vector containing the names of samples from the file to
export to the |
svparam |
A |
yieldSize |
An integer indicating the number of lines of the file to read at once. Increasing this number will make the function faster but consume more RAM. |
expectedAlleles |
An integer indicating the approximate number of alleles that are expected to be imported after filtering and phasing. If this number is too low, the function may slow down considerably. Increasing this number increases the amount of RAM used by the function. |
expectedLoci |
An integer indicating the approximate number of loci that are expected to be imported after filtering and phasing. If this number is too low, the function may slow down considerably. Increasing this number increases the amount of RAM used by the function. |
maxLoci |
An integer indicating the approximate maximum number of loci to return. If
provided, the function will stop reading the file once it has found at least
this many loci that pass filtering and phasing. This argument is intended to
be used for generating small |
This function requires the BioConductor package VariantAnnotation. See https://bioconductor.org/packages/release/bioc/html/VariantAnnotation.html for installation instructions.
If you anticipate running VCF2RADdata on the same file more than once,
it is recommended to run bgzip and indexTabix from the package
Rsamtools once before running VCF2RADdata. See examples.
If the reference genome is large enough to require a .csi index rather than a
.tbi index, after bgzipping the file you can generate the index from the bash
terminal using tabix --csi from Samtools.
min.ind.with.minor.allele is used for filtering SNPs as the VCF file is
read. Additionally, because phasing SNPs into haplotypes can cause some
haplotypes to fail to pass this threshold, VCF2RADdata internally runs
MergeRareHaplotypes with
min.ind.with.haplotype = min.ind.with.minor.allele, then
RemoveMonomorphicLoci, before returning the
final RADdata object.
A RADdata object.
In the python directory of the polyRAD installation, there is a
script called tassel_vcf_tags.py that can identify the full tag
sequence(s) for every allele imported by VCF2RADdata.
Lindsay V. Clark
Variant Call Format specification: http://samtools.github.io/hts-specs/
TASSEL GBSv2 pipeline: https://bitbucket.org/tasseladmin/tassel-5-source/wiki/Tassel5GBSv2Pipeline
GATK: https://gatk.broadinstitute.org/hc/en-us
Tassel4-Poly: https://github.com/guilherme-pereira/tassel4-poly
MakeTasselVcfFilter for filtering to a smaller VCF file before
reading with VCF2RADdata.
To export to VCF: RADdata2VCF
Other data import functions: readStacks, readHMC,
readTagDigger, readTASSELGBSv2,
readProcessIsoloci, readDArTag
# get the example VCF installed with polyRAD exampleVCF <- system.file("extdata", "Msi01genes.vcf", package = "polyRAD") # loading VariantAnnotation namespace takes >10s, # so is excluded from CRAN checks require(VariantAnnotation) # Compress and index the VCF before reading, if not already done if(!file.exists(paste(exampleVCF, "bgz", sep = "."))){ vcfBG <- bgzip(exampleVCF) indexTabix(vcfBG, "vcf") } # Read into RADdata object myRAD <- VCF2RADdata(exampleVCF, expectedLoci = 100, expectedAlleles = 500) # Example of subsetting by genomic region (first 200 kb on Chr01) mysv <- ScanVcfParam(fixed = "ALT", info = NA, geno = "AD", samples = samples(scanVcfHeader(exampleVCF)), which = GRanges("01", IRanges(1, 200000))) myRAD2 <- VCF2RADdata(exampleVCF, expectedLoci = 100, expectedAlleles = 500, svparam = mysv, yieldSize = NA_integer_)# get the example VCF installed with polyRAD exampleVCF <- system.file("extdata", "Msi01genes.vcf", package = "polyRAD") # loading VariantAnnotation namespace takes >10s, # so is excluded from CRAN checks require(VariantAnnotation) # Compress and index the VCF before reading, if not already done if(!file.exists(paste(exampleVCF, "bgz", sep = "."))){ vcfBG <- bgzip(exampleVCF) indexTabix(vcfBG, "vcf") } # Read into RADdata object myRAD <- VCF2RADdata(exampleVCF, expectedLoci = 100, expectedAlleles = 500) # Example of subsetting by genomic region (first 200 kb on Chr01) mysv <- ScanVcfParam(fixed = "ALT", info = NA, geno = "AD", samples = samples(scanVcfHeader(exampleVCF)), which = GRanges("01", IRanges(1, 200000))) myRAD2 <- VCF2RADdata(exampleVCF, expectedLoci = 100, expectedAlleles = 500, svparam = mysv, yieldSize = NA_integer_)